\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901142260:

Variant ID: vg0901142260 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1142260
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TGACCACTAATTATTTTTTGTTCTAAAATATTTAGAAGAGCTATTAAAATAAGATAGTAAAACATACTAAGGATCCTTAAACTTGTTGTTAGATGTCATC[C/T]
AGATCACTGAACTCGGATATGTATTAAAATACCCAAAACTCTAATACTGCTATTGAGGTCCAAAACCGTGTTTTTGACCATTTGAACACCAATGTGGCAC

Reverse complement sequence

GTGCCACATTGGTGTTCAAATGGTCAAAAACACGGTTTTGGACCTCAATAGCAGTATTAGAGTTTTGGGTATTTTAATACATATCCGAGTTCAGTGATCT[G/A]
GATGACATCTAACAACAAGTTTAAGGATCCTTAGTATGTTTTACTATCTTATTTTAATAGCTCTTCTAAATATTTTAGAACAAAAAATAATTAGTGGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 14.00% 0.04% 0.00% NA
All Indica  2759 97.90% 2.10% 0.04% 0.00% NA
All Japonica  1512 66.40% 33.50% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.40% 2.50% 0.11% 0.00% NA
Indica Intermediate  786 96.70% 3.30% 0.00% 0.00% NA
Temperate Japonica  767 97.10% 2.70% 0.13% 0.00% NA
Tropical Japonica  504 25.60% 74.40% 0.00% 0.00% NA
Japonica Intermediate  241 53.90% 46.10% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901142260 C -> T LOC_Os09g02630.1 downstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:64.279; most accessible tissue: Callus, score: 86.865 N N N N
vg0901142260 C -> T LOC_Os09g02640.1 downstream_gene_variant ; 4542.0bp to feature; MODIFIER silent_mutation Average:64.279; most accessible tissue: Callus, score: 86.865 N N N N
vg0901142260 C -> T LOC_Os09g02630-LOC_Os09g02640 intergenic_region ; MODIFIER silent_mutation Average:64.279; most accessible tissue: Callus, score: 86.865 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901142260 NA 1.72E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 3.99E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 2.25E-08 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 1.76E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 9.74E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 3.11E-06 NA mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 4.05E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 9.93E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 1.22E-06 NA mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 6.35E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 6.09E-07 mr1246_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 5.69E-06 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 2.86E-06 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 1.64E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 4.77E-06 NA mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 9.68E-08 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 6.10E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 2.83E-06 NA mr1620_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901142260 NA 1.50E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251