RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0901033665:

Variant ID: vg0901033665 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 1033665
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACATGTCATTCACAGTTAGCATAGGGCAGCGCGATGGAGTACTCACCTGAGGACGGTCGGTAGGGCTCGGTGGCGGCGGCGCTGGGCTCGGTGGAGGG[C/T]
GTCGCTGGTCGGTGGAGGTGGCGTTGGGCTCGGTGGAGGCAGCGGTCTCGGTGGCGGCGGTGGCGGGCTCGGCAACGGAGGAGTTTGCGGCGGCAGCGCC

Reverse complement sequence

GGCGCTGCCGCCGCAAACTCCTCCGTTGCCGAGCCCGCCACCGCCGCCACCGAGACCGCTGCCTCCACCGAGCCCAACGCCACCTCCACCGACCAGCGAC[G/A]
CCCTCCACCGAGCCCAGCGCCGCCGCCACCGAGCCCTACCGACCGTCCTCAGGTGAGTACTCCATCGCGCTGCCCTATGCTAACTGTGAATGACATGTCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	8.80%	1.46%	0.34%	NA
All Indica	2759	96.60%	0.40%	2.46%	0.58%	NA
All Japonica	1512	74.50%	25.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.30%	0.50%	3.03%	0.17%	NA
Indica II	465	94.00%	0.20%	4.52%	1.29%	NA
Indica III	913	98.40%	0.10%	1.10%	0.44%	NA
Indica Intermediate	786	96.20%	0.80%	2.42%	0.64%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	36.90%	63.10%	0.00%	0.00%	NA
Japonica Intermediate	241	78.40%	21.60%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	81.10%	17.80%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0901033665	C -> DEL	LOC_Os09g02490.1	N	frameshift_variant	Average:70.771; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N
vg0901033665	C -> T	LOC_Os09g02490.1	synonymous_variant ; p.Thr109Thr; LOW	synonymous_codon	Average:70.771; most accessible tissue: Zhenshan97 flag leaf, score: 84.998	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0901033665	NA	2.28E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901033665	6.80E-08	NA	mr1023	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	7.79E-06	NA	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	NA	3.04E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	NA	8.68E-08	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	NA	1.46E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	NA	4.10E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	NA	1.57E-08	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	7.79E-06	NA	mr1489	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665	NA	8.09E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 19 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0901033665:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact