\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0901033665:

Variant ID: vg0901033665 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 1033665
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACATGTCATTCACAGTTAGCATAGGGCAGCGCGATGGAGTACTCACCTGAGGACGGTCGGTAGGGCTCGGTGGCGGCGGCGCTGGGCTCGGTGGAGGG[C/T]
GTCGCTGGTCGGTGGAGGTGGCGTTGGGCTCGGTGGAGGCAGCGGTCTCGGTGGCGGCGGTGGCGGGCTCGGCAACGGAGGAGTTTGCGGCGGCAGCGCC

Reverse complement sequence

GGCGCTGCCGCCGCAAACTCCTCCGTTGCCGAGCCCGCCACCGCCGCCACCGAGACCGCTGCCTCCACCGAGCCCAACGCCACCTCCACCGACCAGCGAC[G/A]
CCCTCCACCGAGCCCAGCGCCGCCGCCACCGAGCCCTACCGACCGTCCTCAGGTGAGTACTCCATCGCGCTGCCCTATGCTAACTGTGAATGACATGTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 8.80% 1.46% 0.34% NA
All Indica  2759 96.60% 0.40% 2.46% 0.58% NA
All Japonica  1512 74.50% 25.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.30% 0.50% 3.03% 0.17% NA
Indica II  465 94.00% 0.20% 4.52% 1.29% NA
Indica III  913 98.40% 0.10% 1.10% 0.44% NA
Indica Intermediate  786 96.20% 0.80% 2.42% 0.64% NA
Temperate Japonica  767 98.00% 2.00% 0.00% 0.00% NA
Tropical Japonica  504 36.90% 63.10% 0.00% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 81.10% 17.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0901033665 C -> DEL LOC_Os09g02490.1 N frameshift_variant Average:70.771; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N
vg0901033665 C -> T LOC_Os09g02490.1 synonymous_variant ; p.Thr109Thr; LOW synonymous_codon Average:70.771; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0901033665 NA 2.28E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0901033665 6.80E-08 NA mr1023 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 7.79E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 3.04E-06 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 8.68E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 1.46E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 4.10E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 1.57E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 7.79E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 8.09E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 3.12E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 3.62E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 1.29E-07 NA mr1778 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 1.96E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 2.20E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 2.64E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 5.55E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 5.85E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0901033665 NA 4.60E-08 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251