\
| Variant ID: vg0901033665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 1033665 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGACATGTCATTCACAGTTAGCATAGGGCAGCGCGATGGAGTACTCACCTGAGGACGGTCGGTAGGGCTCGGTGGCGGCGGCGCTGGGCTCGGTGGAGGG[C/T]
GTCGCTGGTCGGTGGAGGTGGCGTTGGGCTCGGTGGAGGCAGCGGTCTCGGTGGCGGCGGTGGCGGGCTCGGCAACGGAGGAGTTTGCGGCGGCAGCGCC
GGCGCTGCCGCCGCAAACTCCTCCGTTGCCGAGCCCGCCACCGCCGCCACCGAGACCGCTGCCTCCACCGAGCCCAACGCCACCTCCACCGACCAGCGAC[G/A]
CCCTCCACCGAGCCCAGCGCCGCCGCCACCGAGCCCTACCGACCGTCCTCAGGTGAGTACTCCATCGCGCTGCCCTATGCTAACTGTGAATGACATGTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 8.80% | 1.46% | 0.34% | NA |
| All Indica | 2759 | 96.60% | 0.40% | 2.46% | 0.58% | NA |
| All Japonica | 1512 | 74.50% | 25.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.30% | 0.50% | 3.03% | 0.17% | NA |
| Indica II | 465 | 94.00% | 0.20% | 4.52% | 1.29% | NA |
| Indica III | 913 | 98.40% | 0.10% | 1.10% | 0.44% | NA |
| Indica Intermediate | 786 | 96.20% | 0.80% | 2.42% | 0.64% | NA |
| Temperate Japonica | 767 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.90% | 63.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0901033665 | C -> DEL | LOC_Os09g02490.1 | N | frameshift_variant | Average:70.771; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 | N | N | N | N |
| vg0901033665 | C -> T | LOC_Os09g02490.1 | synonymous_variant ; p.Thr109Thr; LOW | synonymous_codon | Average:70.771; most accessible tissue: Zhenshan97 flag leaf, score: 84.998 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0901033665 | NA | 2.28E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0901033665 | 6.80E-08 | NA | mr1023 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | 7.79E-06 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 3.04E-06 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 8.68E-08 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 1.46E-07 | mr1206 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 4.10E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 1.57E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | 7.79E-06 | NA | mr1489 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 8.09E-08 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 3.12E-07 | mr1596 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 3.62E-08 | mr1668 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | 1.29E-07 | NA | mr1778 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 1.96E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | 2.20E-06 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 2.64E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | 5.55E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 5.85E-06 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0901033665 | NA | 4.60E-08 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |