\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900936968:

Variant ID: vg0900936968 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 936968
Reference Allele: GTAlternative Allele: GTT,G,AT,GTTT
Primary Allele: GTSecondary Allele: AT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAAGTAGTGGGGGAGGTGGGAACACTACTACAGAAATGCACTAATCTACAGTGCACACAAAACGGAGCGACTCATTAACTCATAATTAATTAAGTATTA[GT/GTT,G,AT,GTTT]
TTTTTTTAAAAAATAGATTAATATAATTTTGTAAAGAAATTTTTGTATAGAATATTTTTGCAAAAACACATCGTTTATTAGTTTGGGAAACGTGCGGAAA

Reverse complement sequence

TTTCCGCACGTTTCCCAAACTAATAAACGATGTGTTTTTGCAAAAATATTCTATACAAAAATTTCTTTACAAAATTATATTAATCTATTTTTTAAAAAAA[AC/AAC,C,AT,AAAC]
TAATACTTAATTAATTATGAGTTAATGAGTCGCTCCGTTTTGTGTGCACTGTAGATTAGTGCATTTCTGTAGTAGTGTTCCCACCTCCCCCACTACTTAC

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of AT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 7.90% 6.43% 0.70% GTT: 2.52%; GTTT: 0.08%; G: 0.08%
All Indica  2759 83.50% 0.40% 10.66% 1.16% GTT: 4.13%; GTTT: 0.14%; G: 0.04%
All Japonica  1512 76.30% 22.80% 0.46% 0.07% G: 0.20%; GTT: 0.13%
Aus  269 99.30% 0.00% 0.00% 0.00% GTT: 0.74%
Indica I  595 84.70% 0.50% 11.43% 0.67% GTT: 2.69%
Indica II  465 84.10% 0.00% 13.33% 2.37% GTT: 0.22%
Indica III  913 81.60% 0.30% 9.75% 1.53% GTT: 6.35%; GTTT: 0.33%; G: 0.11%
Indica Intermediate  786 84.40% 0.60% 9.54% 0.38% GTT: 4.96%; GTTT: 0.13%
Temperate Japonica  767 97.80% 1.80% 0.26% 0.00% G: 0.13%
Tropical Japonica  504 43.70% 55.00% 0.60% 0.00% GTT: 0.40%; G: 0.40%
Japonica Intermediate  241 76.30% 22.40% 0.83% 0.41% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 82.20% 13.30% 3.33% 0.00% GTT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900936968 GT -> DEL N N silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> GTTT LOC_Os09g02284.1 downstream_gene_variant ; 2883.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> GTTT LOC_Os09g02300.1 downstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> GTTT LOC_Os09g02284-LOC_Os09g02300 intergenic_region ; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> GTT LOC_Os09g02284.1 downstream_gene_variant ; 2883.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> GTT LOC_Os09g02300.1 downstream_gene_variant ; 84.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> GTT LOC_Os09g02284-LOC_Os09g02300 intergenic_region ; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> G LOC_Os09g02284.1 downstream_gene_variant ; 2882.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> G LOC_Os09g02300.1 downstream_gene_variant ; 85.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> G LOC_Os09g02284-LOC_Os09g02300 intergenic_region ; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> AT LOC_Os09g02284.1 downstream_gene_variant ; 2881.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> AT LOC_Os09g02300.1 downstream_gene_variant ; 86.0bp to feature; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N
vg0900936968 GT -> AT LOC_Os09g02284-LOC_Os09g02300 intergenic_region ; MODIFIER silent_mutation Average:96.164; most accessible tissue: Callus, score: 98.333 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0900936968 GT AT 0.01 0.01 0.0 0.0 -0.01 -0.01
vg0900936968 GT G -0.15 -0.14 -0.1 -0.11 -0.12 -0.19
vg0900936968 GT GTT 0.01 0.01 0.03 0.01 0.0 -0.01
vg0900936968 GT GTTT 0.02 0.01 0.06 0.02 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900936968 2.70E-07 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 3.07E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 2.44E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 2.59E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 3.66E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 8.57E-06 NA mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 NA 3.87E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 8.31E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 NA 9.88E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 NA 4.85E-09 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900936968 NA 1.47E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251