Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900894793:

Variant ID: vg0900894793 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 894793
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCCTGGCTATGGTAGGGTGGCTGATGCTAGACCAGTCGATTCTTTGTTTAATCCCAGTGCATCTAAACCCTTAATTATTTTGGTCATTAATAACAATG[T/C]
GATTAGTGAGGACTAATTATTTGTTTGAGACTAAGTGAAGGAATTTTAGTTCTCCATGAAGTAATGTTAAAGGCAAAATCCGTTTGTGTTGCAAATATGA

Reverse complement sequence

TCATATTTGCAACACAAACGGATTTTGCCTTTAACATTACTTCATGGAGAACTAAAATTCCTTCACTTAGTCTCAAACAAATAATTAGTCCTCACTAATC[A/G]
CATTGTTATTAATGACCAAAATAATTAAGGGTTTAGATGCACTGGGATTAAACAAAGAATCGACTGGTCTAGCATCAGCCACCCTACCATAGCCAGGAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	34.70%	0.02%	0.00%	NA
All Indica	2759	95.50%	4.50%	0.04%	0.00%	NA
All Japonica	1512	3.70%	96.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	94.80%	5.20%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	96.40%	3.60%	0.00%	0.00%	NA
Indica Intermediate	786	93.50%	6.40%	0.13%	0.00%	NA
Temperate Japonica	767	5.30%	94.70%	0.00%	0.00%	NA
Tropical Japonica	504	1.80%	98.20%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	55.60%	44.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900894793	T -> C	LOC_Os09g02230.1	downstream_gene_variant ; 84.0bp to feature; MODIFIER	silent_mutation	Average:46.167; most accessible tissue: Callus, score: 69.421	N	N	N	N
vg0900894793	T -> C	LOC_Os09g02214.3	downstream_gene_variant ; 4607.0bp to feature; MODIFIER	silent_mutation	Average:46.167; most accessible tissue: Callus, score: 69.421	N	N	N	N
vg0900894793	T -> C	LOC_Os09g02230-LOC_Os09g02240	intergenic_region ; MODIFIER	silent_mutation	Average:46.167; most accessible tissue: Callus, score: 69.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900894793	NA	4.05E-28	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	6.79E-27	mr1122	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	3.86E-22	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	4.91E-46	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	3.15E-16	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	7.18E-24	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	5.86E-39	mr1480	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	1.37E-67	mr1896	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	1.14E-74	mr1934	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	3.91E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	7.02E-25	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	3.57E-30	mr1102_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	1.11E-21	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	4.26E-53	mr1194_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	1.33E-18	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	9.57E-16	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	1.82E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	5.80E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	5.10E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	3.52E-66	mr1889_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	1.92E-19	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900894793	NA	2.85E-82	mr1934_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251