\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900843348:

Variant ID: vg0900843348 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 843348
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGGGAGCAATAACCATGGAAAAGCTCCAAAATAATCTCTTACTGCATAGTTGACGATGCAGTTAGATTTTAAAGCATGTTATGATTAATCATATTTCC[C/T]
AGAACTAAGAGTGGTAAATAGCGCTCATAAACCACTCAAAAGGTGTAAACCACTCAATTGTACTGTGTTATAAGTTGTGCACTAATTGAACACAGTTTTT

Reverse complement sequence

AAAAACTGTGTTCAATTAGTGCACAACTTATAACACAGTACAATTGAGTGGTTTACACCTTTTGAGTGGTTTATGAGCGCTATTTACCACTCTTAGTTCT[G/A]
GGAAATATGATTAATCATAACATGCTTTAAAATCTAACTGCATCGTCAACTATGCAGTAAGAGATTATTTTGGAGCTTTTCCATGGTTATTGCTCCCCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.00% 0.17% 0.00% NA
All Indica  2759 98.00% 2.00% 0.00% 0.00% NA
All Japonica  1512 85.80% 13.70% 0.46% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.30% 2.70% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.90% 0.00% 0.00% NA
Temperate Japonica  767 97.50% 2.10% 0.39% 0.00% NA
Tropical Japonica  504 81.20% 18.30% 0.60% 0.00% NA
Japonica Intermediate  241 58.50% 41.10% 0.41% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 91.10% 7.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900843348 C -> T LOC_Os09g02150.1 upstream_gene_variant ; 799.0bp to feature; MODIFIER silent_mutation Average:26.199; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N
vg0900843348 C -> T LOC_Os09g02140-LOC_Os09g02150 intergenic_region ; MODIFIER silent_mutation Average:26.199; most accessible tissue: Minghui63 young leaf, score: 38.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900843348 7.88E-06 7.88E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 5.39E-08 5.39E-08 mr1192_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 NA 1.88E-07 mr1200_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 6.79E-06 6.79E-06 mr1278_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 1.60E-06 1.60E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 4.42E-06 4.41E-06 mr1374_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 7.20E-06 7.19E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 NA 6.89E-06 mr1665_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 3.79E-06 3.79E-06 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 NA 1.47E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 NA 3.53E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 5.10E-06 5.10E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 1.47E-06 1.47E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 NA 1.64E-06 mr1861_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843348 7.09E-06 7.09E-06 mr1877_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251