Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900843177:

Variant ID: vg0900843177 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 843177
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACTAGACCACTGGTATTAAGAATGTTTTGTATTATTCACAAGGCAATCTTAAGTAACATGCTTATATTTCTAAAGTCCAATGATCTCAGAAGTTTAGAGA[T/C]
ATTTGGACACTTATTTTGCGAGATGTGTGGATATTTATAAAGATTATTCAGATTAAGCTATATCCACACATAGGGGAGCAATAACCATGGAAAAGCTCCA

Reverse complement sequence

TGGAGCTTTTCCATGGTTATTGCTCCCCTATGTGTGGATATAGCTTAATCTGAATAATCTTTATAAATATCCACACATCTCGCAAAATAAGTGTCCAAAT[A/G]
TCTCTAAACTTCTGAGATCATTGGACTTTAGAAATATAAGCATGTTACTTAAGATTGCCTTGTGAATAATACAAAACATTCTTAATACCAGTGGTCTAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	28.30%	0.00%	0.04%	NA
All Indica	2759	97.60%	2.40%	0.00%	0.07%	NA
All Japonica	1512	23.70%	76.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.50%	4.50%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.30%	0.00%	0.25%	NA
Temperate Japonica	767	19.80%	80.20%	0.00%	0.00%	NA
Tropical Japonica	504	20.00%	80.00%	0.00%	0.00%	NA
Japonica Intermediate	241	44.00%	56.00%	0.00%	0.00%	NA
VI/Aromatic	96	22.90%	77.10%	0.00%	0.00%	NA
Intermediate	90	52.20%	47.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900843177	T -> DEL	N	N	silent_mutation	Average:26.343; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0900843177	T -> C	LOC_Os09g02150.1	upstream_gene_variant ; 970.0bp to feature; MODIFIER	silent_mutation	Average:26.343; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg0900843177	T -> C	LOC_Os09g02140-LOC_Os09g02150	intergenic_region ; MODIFIER	silent_mutation	Average:26.343; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900843177	NA	6.33E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	3.61E-15	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	3.92E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	1.32E-12	mr1326	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	2.17E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	2.07E-11	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	9.39E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	4.02E-06	3.11E-10	mr1781	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	1.43E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	2.27E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	2.24E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	4.50E-10	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	5.29E-06	mr1648_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	3.43E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	8.16E-07	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	3.71E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	1.12E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900843177	NA	7.33E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251