\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900837068:

Variant ID: vg0900837068 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 837068
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.10, others allele: 0.00, population size: 68. )

Flanking Sequence (100 bp) in Reference Genome:


TATCTTTCGGCGGATAATTTTTGGATCGTTCGGATACAGAATATGAATACGGATATGGTACTGGGGTTTTCGTCGGATACGGATAATAATTCAGATATCC[A/G]
GTGAATAGTGCTATTCGGATATCCGCAAAAGCCATGAGACATACCCCCATTTCTTTCTAACTCTATAACCTTCAATATACCTTTATAGATTTTAATAGTA

Reverse complement sequence

TACTATTAAAATCTATAAAGGTATATTGAAGGTTATAGAGTTAGAAAGAAATGGGGGTATGTCTCATGGCTTTTGCGGATATCCGAATAGCACTATTCAC[T/C]
GGATATCTGAATTATTATCCGTATCCGACGAAAACCCCAGTACCATATCCGTATTCATATTCTGTATCCGAACGATCCAAAAATTATCCGCCGAAAGATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 26.10% 0.04% 6.01% NA
All Indica  2759 95.90% 2.10% 0.04% 1.92% NA
All Japonica  1512 10.60% 75.50% 0.00% 13.96% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 94.80% 4.20% 0.00% 1.01% NA
Indica II  465 98.70% 1.10% 0.00% 0.22% NA
Indica III  913 96.60% 0.70% 0.00% 2.74% NA
Indica Intermediate  786 94.40% 2.80% 0.13% 2.67% NA
Temperate Japonica  767 18.50% 79.30% 0.00% 2.22% NA
Tropical Japonica  504 1.60% 79.80% 0.00% 18.65% NA
Japonica Intermediate  241 4.10% 54.40% 0.00% 41.49% NA
VI/Aromatic  96 84.40% 1.00% 0.00% 14.58% NA
Intermediate  90 57.80% 35.60% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900837068 A -> G LOC_Os09g02140-LOC_Os09g02150 intergenic_region ; MODIFIER silent_mutation Average:33.062; most accessible tissue: Callus, score: 47.362 N N N N
vg0900837068 A -> DEL N N silent_mutation Average:33.062; most accessible tissue: Callus, score: 47.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900837068 NA 6.45E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 4.08E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 7.70E-17 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 4.56E-16 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 1.75E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 2.30E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 2.93E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 3.29E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 8.27E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 1.13E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 1.27E-13 mr1623 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 8.91E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 1.13E-08 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 1.70E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 4.45E-09 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 9.10E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 3.35E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 4.87E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900837068 NA 1.18E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251