\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900764359:

Variant ID: vg0900764359 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 764359
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GCATCTCATCATCCCACCATTTAACTAAGATGGGCAGACGAGAATCTTCAGCTGATCGAATTCGAAGGACTTCTTCTTCATCACCAATCATCGGGCCTTT[G/A]
CGATCTGTATTCAGAGGGTTGTTACCTGTTATAATCTTCGGTGGAGGACGAGCAGGTCCTTGAACCTTATCAAAAGAACTAGCCTCTGGACCAGTATTGG

Reverse complement sequence

CCAATACTGGTCCAGAGGCTAGTTCTTTTGATAAGGTTCAAGGACCTGCTCGTCCTCCACCGAAGATTATAACAGGTAACAACCCTCTGAATACAGATCG[C/T]
AAAGGCCCGATGATTGGTGATGAAGAAGAAGTCCTTCGAATTCGATCAGCTGAAGATTCTCGTCTGCCCATCTTAGTTAAATGGTGGGATGATGAGATGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.30% 0.30% 2.01% 62.40% NA
All Indica  2759 4.30% 0.40% 0.29% 95.07% NA
All Japonica  1512 98.60% 0.00% 0.33% 1.06% NA
Aus  269 0.70% 0.40% 0.37% 98.51% NA
Indica I  595 5.50% 0.30% 0.17% 93.95% NA
Indica II  465 1.30% 0.40% 0.00% 98.28% NA
Indica III  913 3.40% 0.20% 0.22% 96.17% NA
Indica Intermediate  786 6.10% 0.50% 0.64% 92.75% NA
Temperate Japonica  767 99.30% 0.00% 0.00% 0.65% NA
Tropical Japonica  504 98.40% 0.00% 0.40% 1.19% NA
Japonica Intermediate  241 96.70% 0.00% 1.24% 2.07% NA
VI/Aromatic  96 16.70% 2.10% 75.00% 6.25% NA
Intermediate  90 46.70% 0.00% 10.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900764359 G -> DEL LOC_Os09g02080.1 N frameshift_variant Average:49.307; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0900764359 G -> A LOC_Os09g02080.1 synonymous_variant ; p.Arg452Arg; LOW synonymous_codon Average:49.307; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900764359 NA 1.42E-19 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 4.14E-23 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 1.18E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 4.00E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 8.66E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 1.82E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 2.36E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 5.31E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 7.19E-06 6.65E-06 mr1975 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 7.62E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 8.25E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 6.87E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 4.99E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 5.21E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 2.22E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 1.16E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900764359 NA 6.28E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251