\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900756178:

Variant ID: vg0900756178 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 756178
Reference Allele: TAlternative Allele: C,TC,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCAACACAAATAAATAAGAAACAATTCCTTATTTTGTTTTTCATTGTTTGCTTATTTGACCCTGCTTTTCAAAATTGAACACCCCATCTGACTCTTTTTT[T/C,TC,A]
ATTACACTGTTATGGTTTTATTTAGGAACAAGAAAAAAAACTATTTACTATTTAACTGACCAAAATACCCCCAAGATACTTCAACCCTATCCTATCCAGT

Reverse complement sequence

ACTGGATAGGATAGGGTTGAAGTATCTTGGGGGTATTTTGGTCAGTTAAATAGTAAATAGTTTTTTTTCTTGTTCCTAAATAAAACCATAACAGTGTAAT[A/G,GA,T]
AAAAAAGAGTCAGATGGGGTGTTCAATTTTGAAAAGCAGGGTCAAATAAGCAAACAATGAAAAACAAAATAAGGAATTGTTTCTTATTTATTTGTGTTGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 18.30% 0.11% 0.00% TC: 2.45%; A: 0.06%
All Indica  2759 96.30% 3.50% 0.00% 0.00% TC: 0.18%; A: 0.04%
All Japonica  1512 44.60% 48.10% 0.26% 0.00% TC: 6.88%; A: 0.07%
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 0.70% 0.00% 0.00% TC: 0.50%
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.10% 0.00% 0.00% TC: 0.25%; A: 0.13%
Temperate Japonica  767 76.40% 21.80% 0.00% 0.00% TC: 1.83%
Tropical Japonica  504 2.80% 90.30% 0.60% 0.00% TC: 6.35%
Japonica Intermediate  241 31.10% 44.00% 0.41% 0.00% TC: 24.07%; A: 0.41%
VI/Aromatic  96 83.30% 9.40% 0.00% 0.00% TC: 6.25%; A: 1.04%
Intermediate  90 65.60% 32.20% 1.11% 0.00% TC: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900756178 T -> TC LOC_Os09g02060.1 upstream_gene_variant ; 3089.0bp to feature; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> TC LOC_Os09g02070.1 upstream_gene_variant ; 682.0bp to feature; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> TC LOC_Os09g02060-LOC_Os09g02070 intergenic_region ; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> C LOC_Os09g02060.1 upstream_gene_variant ; 3088.0bp to feature; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> C LOC_Os09g02070.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> C LOC_Os09g02060-LOC_Os09g02070 intergenic_region ; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> A LOC_Os09g02060.1 upstream_gene_variant ; 3088.0bp to feature; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> A LOC_Os09g02070.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N
vg0900756178 T -> A LOC_Os09g02060-LOC_Os09g02070 intergenic_region ; MODIFIER silent_mutation Average:84.686; most accessible tissue: Zhenshan97 panicle, score: 95.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0900756178 T A 0.0 -0.01 0.0 0.0 0.0 0.0
vg0900756178 T C -0.03 -0.02 -0.01 -0.03 -0.02 -0.02
vg0900756178 T TC 0.05 -0.04 -0.01 0.05 0.07 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900756178 NA 5.09E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 3.46E-11 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.39E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 4.93E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.42E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 3.21E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 8.84E-10 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.07E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 9.92E-17 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 3.98E-09 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 9.46E-07 mr1152_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.09E-07 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 8.40E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 4.68E-08 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.17E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.96E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 5.20E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 4.55E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 8.13E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 6.30E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.26E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 8.10E-08 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.36E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 6.17E-07 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 5.36E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 2.47E-09 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 2.32E-06 mr1715_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.09E-10 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 1.40E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900756178 NA 5.35E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251