\
| Variant ID: vg0900715492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 715492 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAAGGGGGTTCCCAACCGGGAGTAAAAAGGGTTTCTCTACCAGTGAGTAACACAACACATGCATGGTAACAGCCATGAGTCTGAAACACGCGCTGCTAC[G/A]
AGAAAGTTTTTTCGTACGGTCAAATCCGATTTTTACATCTTACGGTAAAATCCGATTTTTACATCTTGGTGGACGGTCCGCACGCACCCAGGAGTCTGCA
TGCAGACTCCTGGGTGCGTGCGGACCGTCCACCAAGATGTAAAAATCGGATTTTACCGTAAGATGTAAAAATCGGATTTGACCGTACGAAAAAACTTTCT[C/T]
GTAGCAGCGCGTGTTTCAGACTCATGGCTGTTACCATGCATGTGTTGTGTTACTCACTGGTAGAGAAACCCTTTTTACTCCCGGTTGGGAACCCCCTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 24.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900715492 | G -> A | LOC_Os09g02020.1 | upstream_gene_variant ; 4548.0bp to feature; MODIFIER | silent_mutation | Average:56.722; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| vg0900715492 | G -> A | LOC_Os09g02020-LOC_Os09g02030 | intergenic_region ; MODIFIER | silent_mutation | Average:56.722; most accessible tissue: Minghui63 flag leaf, score: 70.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900715492 | 3.01E-06 | 3.01E-06 | mr1065 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900715492 | 4.62E-06 | 4.62E-06 | mr1068 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900715492 | NA | 7.44E-06 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900715492 | 7.43E-06 | 1.78E-06 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900715492 | 1.36E-06 | 1.36E-06 | mr1526 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |