\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900708420:

Variant ID: vg0900708420 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 708420
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAGCGGCGGTGAAGCGGGCCCAAGTAATAGGCTGCCCTTCTGGCTGCGTAGCCTGGAAATGGTCCCACCATAGAGATGCGGGCCCCTGCAGTTGGTG[A/G]
GCGGCGAAGATGACTTTCTCCTCATCGCTGCACTGCACGGTGTCTAACTTTTTCCCCACGGCATGCAACCAATCCAACGCATCCACGGGGTTATTGGAGC

Reverse complement sequence

GCTCCAATAACCCCGTGGATGCGTTGGATTGGTTGCATGCCGTGGGGAAAAAGTTAGACACCGTGCAGTGCAGCGATGAGGAGAAAGTCATCTTCGCCGC[T/C]
CACCAACTGCAGGGGCCCGCATCTCTATGGTGGGACCATTTCCAGGCTACGCAGCCAGAAGGGCAGCCTATTACTTGGGCCCGCTTCACCGCCGCTTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 26.60% 16.10% 6.92% 50.30% NA
All Indica  2759 6.20% 3.00% 8.05% 82.78% NA
All Japonica  1512 55.80% 43.30% 0.07% 0.79% NA
Aus  269 42.80% 1.90% 37.55% 17.84% NA
Indica I  595 3.90% 5.70% 3.70% 86.72% NA
Indica II  465 7.70% 1.90% 4.95% 85.38% NA
Indica III  913 6.20% 0.40% 12.81% 80.50% NA
Indica Intermediate  786 7.00% 4.50% 7.63% 80.92% NA
Temperate Japonica  767 23.90% 75.60% 0.00% 0.52% NA
Tropical Japonica  504 98.00% 0.80% 0.00% 1.19% NA
Japonica Intermediate  241 69.30% 29.50% 0.41% 0.83% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 42.20% 22.20% 3.33% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900708420 A -> G LOC_Os09g02020.1 synonymous_variant ; p.Ala379Ala; LOW synonymous_codon Average:31.067; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0900708420 A -> DEL LOC_Os09g02020.1 N frameshift_variant Average:31.067; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900708420 NA 5.15E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 2.65E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.15E-08 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 2.54E-06 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.14E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 3.43E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 2.02E-09 mr1206_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.28E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 8.29E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 2.29E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.53E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.10E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.19E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 7.54E-06 2.37E-09 mr1596_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 3.80E-07 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 9.83E-11 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.07E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900708420 NA 1.39E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251