Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900651975:

Variant ID: vg0900651975 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 651975
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.63, G: 0.37, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAATAATCCTTTTTAATTTAGGAACTTAGCACCTCAAACAATCCAATCTGAGATTCGTTCATATAGAGAATTGATCTCAAAACTTTGGGGATACTTAC[A/G]
TCACTGCAACCACTAGGCTTGCCGTCTGCTTGATCTCACTGTTTCATAGGAAGAAAAAGCTAAGAACATGTACTTACTCTTAAGTTCGGTTAATTATTCA

Reverse complement sequence

TGAATAATTAACCGAACTTAAGAGTAAGTACATGTTCTTAGCTTTTTCTTCCTATGAAACAGTGAGATCAAGCAGACGGCAAGCCTAGTGGTTGCAGTGA[T/C]
GTAAGTATCCCCAAAGTTTTGAGATCAATTCTCTATATGAACGAATCTCAGATTGGATTGTTTGAGGTGCTAAGTTCCTAAATTAAAAAGGATTATTTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.80%	36.20%	0.04%	0.00%	NA
All Indica	2759	97.30%	2.70%	0.00%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.10%	4.90%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.40%	3.60%	0.00%	0.00%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	1.20%	98.80%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	43.30%	54.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900651975	A -> G	LOC_Os09g01960.1	downstream_gene_variant ; 4450.0bp to feature; MODIFIER	silent_mutation	Average:58.846; most accessible tissue: Minghui63 root, score: 85.569	N	N	N	N
vg0900651975	A -> G	LOC_Os09g01950-LOC_Os09g01960	intergenic_region ; MODIFIER	silent_mutation	Average:58.846; most accessible tissue: Minghui63 root, score: 85.569	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900651975	NA	1.16E-117	mr1008	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	2.28E-116	mr1009	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	3.25E-75	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	2.73E-78	mr1015	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	7.20E-69	mr1027	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	1.17E-21	mr1122	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	4.12E-87	mr1517	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	1.98E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	2.90E-43	mr1563	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	3.77E-32	mr1647	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	3.16E-36	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	4.65E-59	mr1695	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	2.76E-19	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	7.20E-92	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	5.13E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	1.39E-67	mr1896	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	1.30E-116	mr1008_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	1.18E-86	mr1015_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900651975	NA	1.46E-43	mr1542_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251