Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900608673:

Variant ID: vg0900608673 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 608673
Reference Allele: G	Alternative Allele: A,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CATCATCCACCCAGTACTGACTGCTGCCCTCTGCGATCGTGTCTAACAGGATTTGTTCGTCATCGCGGTCTGCCATCTGTGCGTGCAAAGAAAAAAAGAC[G/A,C]
GTGAGGTCATGGACATCAACATGTATAGCTCATACATCTAAACCCTACAAGTATACATGTATAATTCGCTAAGTCGTTGTTCTCGTTAAGTCGTTAAGTC

Reverse complement sequence

GACTTAACGACTTAACGAGAACAACGACTTAGCGAATTATACATGTATACTTGTAGGGTTTAGATGTATGAGCTATACATGTTGATGTCCATGACCTCAC[C/T,G]
GTCTTTTTTTCTTTGCACGCACAGATGGCAGACCGCGATGACGAACAAATCCTGTTAGACACGATCGCAGAGGGCAGCAGTCAGTACTGGGTGGATGATG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.60%	27.90%	1.80%	4.72%	NA
All Indica	2759	96.70%	3.10%	0.18%	0.00%	NA
All Japonica	1512	2.40%	77.60%	5.22%	14.68%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	92.80%	7.10%	0.17%	0.00%	NA
Indica II	465	98.30%	1.70%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	2.90%	0.51%	0.00%	NA
Temperate Japonica	767	2.20%	69.90%	2.09%	25.81%	NA
Tropical Japonica	504	1.60%	85.10%	11.51%	1.79%	NA
Japonica Intermediate	241	5.00%	86.70%	2.07%	6.22%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	51.10%	46.70%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900608673	G -> DEL	N	N	silent_mutation	Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0900608673	G -> C	LOC_Os09g01900.1	upstream_gene_variant ; 25.0bp to feature; MODIFIER	N	Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0900608673	G -> C	LOC_Os09g01910.1	downstream_gene_variant ; 1701.0bp to feature; MODIFIER	N	Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0900608673	G -> C	LOC_Os09g01900-LOC_Os09g01910	intergenic_region ; MODIFIER	N	Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0900608673	G -> A	LOC_Os09g01900.1	upstream_gene_variant ; 25.0bp to feature; MODIFIER	silent_mutation	Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0900608673	G -> A	LOC_Os09g01910.1	downstream_gene_variant ; 1701.0bp to feature; MODIFIER	silent_mutation	Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N
vg0900608673	G -> A	LOC_Os09g01900-LOC_Os09g01910	intergenic_region ; MODIFIER	silent_mutation	Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900608673	NA	3.41E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	1.91E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	3.54E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	1.08E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	2.06E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	7.00E-07	NA	mr1080_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	1.91E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	4.59E-21	mr1168_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	7.11E-06	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	3.13E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	5.04E-20	mr1383_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	3.93E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	4.68E-06	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	8.15E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	1.55E-06	NA	mr1619_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	7.73E-07	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	6.96E-22	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	1.97E-06	NA	mr1758_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	9.95E-20	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	2.53E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	7.12E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	3.78E-18	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	6.23E-06	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673	NA	1.73E-21	mr1968_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251