\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900608673:

Variant ID: vg0900608673 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 608673
Reference Allele: GAlternative Allele: A,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CATCATCCACCCAGTACTGACTGCTGCCCTCTGCGATCGTGTCTAACAGGATTTGTTCGTCATCGCGGTCTGCCATCTGTGCGTGCAAAGAAAAAAAGAC[G/A,C]
GTGAGGTCATGGACATCAACATGTATAGCTCATACATCTAAACCCTACAAGTATACATGTATAATTCGCTAAGTCGTTGTTCTCGTTAAGTCGTTAAGTC

Reverse complement sequence

GACTTAACGACTTAACGAGAACAACGACTTAGCGAATTATACATGTATACTTGTAGGGTTTAGATGTATGAGCTATACATGTTGATGTCCATGACCTCAC[C/T,G]
GTCTTTTTTTCTTTGCACGCACAGATGGCAGACCGCGATGACGAACAAATCCTGTTAGACACGATCGCAGAGGGCAGCAGTCAGTACTGGGTGGATGATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 27.90% 1.80% 4.72% NA
All Indica  2759 96.70% 3.10% 0.18% 0.00% NA
All Japonica  1512 2.40% 77.60% 5.22% 14.68% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 92.80% 7.10% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 2.90% 0.51% 0.00% NA
Temperate Japonica  767 2.20% 69.90% 2.09% 25.81% NA
Tropical Japonica  504 1.60% 85.10% 11.51% 1.79% NA
Japonica Intermediate  241 5.00% 86.70% 2.07% 6.22% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 51.10% 46.70% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900608673 G -> DEL N N silent_mutation Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0900608673 G -> C LOC_Os09g01900.1 upstream_gene_variant ; 25.0bp to feature; MODIFIER N Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0900608673 G -> C LOC_Os09g01910.1 downstream_gene_variant ; 1701.0bp to feature; MODIFIER N Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0900608673 G -> C LOC_Os09g01900-LOC_Os09g01910 intergenic_region ; MODIFIER N Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0900608673 G -> A LOC_Os09g01900.1 upstream_gene_variant ; 25.0bp to feature; MODIFIER silent_mutation Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0900608673 G -> A LOC_Os09g01910.1 downstream_gene_variant ; 1701.0bp to feature; MODIFIER silent_mutation Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N
vg0900608673 G -> A LOC_Os09g01900-LOC_Os09g01910 intergenic_region ; MODIFIER silent_mutation Average:38.83; most accessible tissue: Zhenshan97 flag leaf, score: 73.475 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900608673 NA 3.41E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 1.91E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 3.54E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 1.08E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 2.06E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 7.00E-07 NA mr1080_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 1.91E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 4.59E-21 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 7.11E-06 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 3.13E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 5.04E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 3.93E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 4.68E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 8.15E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 1.55E-06 NA mr1619_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 7.73E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 6.96E-22 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 1.97E-06 NA mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 9.95E-20 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 2.53E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 7.12E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 3.78E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 6.23E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900608673 NA 1.73E-21 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251