\
| Variant ID: vg0900606900 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 606900 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGACTTGGTAGCAGGTGCACGCGGAGGAGTAGTTGCCCGCGGGCCCGACGGTGTAGACTTGGCAGCTGGTGCACGCGGAGGAGGTGGTGGTGCAGGGGAA[G/A]
GAGCCGGAGGAGACTAACGAGGCAGTGATGGCGGAGGAGACTATGCTTGCGGCCGGGAAGGAGGAGCGGGCGGCCGTTCTTGCCCGGGAAACACGATGTA
TACATCGTGTTTCCCGGGCAAGAACGGCCGCCCGCTCCTCCTTCCCGGCCGCAAGCATAGTCTCCTCCGCCATCACTGCCTCGTTAGTCTCCTCCGGCTC[C/T]
TTCCCCTGCACCACCACCTCCTCCGCGTGCACCAGCTGCCAAGTCTACACCGTCGGGCCCGCGGGCAACTACTCCTCCGCGTGCACCTGCTACCAAGTCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 21.80% | 0.87% | 5.29% | NA |
| All Indica | 2759 | 61.40% | 37.10% | 1.05% | 0.40% | NA |
| All Japonica | 1512 | 83.30% | 0.10% | 0.79% | 15.74% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 66.20% | 31.90% | 1.68% | 0.17% | NA |
| Indica II | 465 | 81.10% | 16.80% | 0.86% | 1.29% | NA |
| Indica III | 913 | 49.00% | 49.90% | 0.77% | 0.33% | NA |
| Indica Intermediate | 786 | 60.70% | 38.20% | 1.02% | 0.13% | NA |
| Temperate Japonica | 767 | 70.30% | 0.10% | 1.17% | 28.42% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 0.00% | 1.24% | 8.30% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900606900 | G -> DEL | N | N | silent_mutation | Average:54.775; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| vg0900606900 | G -> A | LOC_Os09g01910.1 | downstream_gene_variant ; 3474.0bp to feature; MODIFIER | silent_mutation | Average:54.775; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| vg0900606900 | G -> A | LOC_Os09g01900.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.775; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900606900 | NA | 4.48E-07 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 3.49E-06 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 1.95E-07 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 1.30E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 5.82E-07 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | 3.06E-06 | 7.29E-07 | mr1199 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 5.01E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 2.24E-07 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 6.16E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606900 | NA | 1.35E-06 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |