\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900606900:

Variant ID: vg0900606900 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 606900
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGACTTGGTAGCAGGTGCACGCGGAGGAGTAGTTGCCCGCGGGCCCGACGGTGTAGACTTGGCAGCTGGTGCACGCGGAGGAGGTGGTGGTGCAGGGGAA[G/A]
GAGCCGGAGGAGACTAACGAGGCAGTGATGGCGGAGGAGACTATGCTTGCGGCCGGGAAGGAGGAGCGGGCGGCCGTTCTTGCCCGGGAAACACGATGTA

Reverse complement sequence

TACATCGTGTTTCCCGGGCAAGAACGGCCGCCCGCTCCTCCTTCCCGGCCGCAAGCATAGTCTCCTCCGCCATCACTGCCTCGTTAGTCTCCTCCGGCTC[C/T]
TTCCCCTGCACCACCACCTCCTCCGCGTGCACCAGCTGCCAAGTCTACACCGTCGGGCCCGCGGGCAACTACTCCTCCGCGTGCACCTGCTACCAAGTCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 21.80% 0.87% 5.29% NA
All Indica  2759 61.40% 37.10% 1.05% 0.40% NA
All Japonica  1512 83.30% 0.10% 0.79% 15.74% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 66.20% 31.90% 1.68% 0.17% NA
Indica II  465 81.10% 16.80% 0.86% 1.29% NA
Indica III  913 49.00% 49.90% 0.77% 0.33% NA
Indica Intermediate  786 60.70% 38.20% 1.02% 0.13% NA
Temperate Japonica  767 70.30% 0.10% 1.17% 28.42% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 0.00% 1.24% 8.30% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900606900 G -> DEL N N silent_mutation Average:54.775; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0900606900 G -> A LOC_Os09g01910.1 downstream_gene_variant ; 3474.0bp to feature; MODIFIER silent_mutation Average:54.775; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N
vg0900606900 G -> A LOC_Os09g01900.1 intron_variant ; MODIFIER silent_mutation Average:54.775; most accessible tissue: Zhenshan97 flag leaf, score: 80.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900606900 NA 4.48E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 3.49E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 1.95E-07 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 1.30E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 5.82E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 3.06E-06 7.29E-07 mr1199 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 5.01E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 2.24E-07 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 6.16E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900606900 NA 1.35E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251