\
| Variant ID: vg0900606284 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 606284 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 130. )
AATCTGAGTTTCGCACCCTAGCTCCGAACATCTCTCTACCCATCCCTGATTTGTCCATGTACCATTGATGGAACCGGTACATCTGTGTAGGTAGCTCTCT[G/A]
ATCTTATCAGGCGTGACTAGCAGTTCACCGAGTTTAAACGTGTACATGACCGGAGCCGTTTCGATAGGTGCGTCCTCTAGCAACTGCTCCATACTCAGTC
GACTGAGTATGGAGCAGTTGCTAGAGGACGCACCTATCGAAACGGCTCCGGTCATGTACACGTTTAAACTCGGTGAACTGCTAGTCACGCCTGATAAGAT[C/T]
AGAGAGCTACCTACACAGATGTACCGGTTCCATCAATGGTACATGGACAAATCAGGGATGGGTAGAGAGATGTTCGGAGCTAGGGTGCGAAACTCAGATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.80% | 21.30% | 0.66% | 5.23% | NA |
| All Indica | 2759 | 62.70% | 36.30% | 0.91% | 0.04% | NA |
| All Japonica | 1512 | 83.40% | 0.10% | 0.33% | 16.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.10% | 31.90% | 0.84% | 0.17% | NA |
| Indica II | 465 | 83.00% | 16.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 50.30% | 48.70% | 0.99% | 0.00% | NA |
| Indica Intermediate | 786 | 62.00% | 37.00% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 70.50% | 0.10% | 0.13% | 29.20% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.00% | 0.00% | 1.24% | 8.71% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900606284 | G -> DEL | LOC_Os09g01900.1 | N | frameshift_variant | Average:35.145; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| vg0900606284 | G -> A | LOC_Os09g01900.1 | synonymous_variant ; p.Ile597Ile; LOW | synonymous_codon | Average:35.145; most accessible tissue: Zhenshan97 flag leaf, score: 70.837 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900606284 | NA | 1.81E-07 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 7.78E-07 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | 5.47E-06 | 1.59E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 2.83E-08 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 1.15E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 4.49E-06 | mr1131 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | 1.95E-06 | NA | mr1213 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | 1.55E-07 | 9.06E-12 | mr1213 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 7.04E-06 | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 1.58E-08 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 8.97E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 3.93E-06 | mr1404 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | 3.94E-06 | 1.09E-07 | mr1620 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900606284 | NA | 2.44E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |