\
| Variant ID: vg0900591523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 591523 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 195. )
CGACCATTAGAAATTAAAATACAACTTAAGAATTGATGGTGTAAGGAATATGCATTATTTACCATGGACTCACGACAATTTGAGCTACGGCTGATCAGCT[G/A]
CGGGGGAAAAAAACAAAGCAACCTTTTATTTATCTGTGCTGTTAGCAGTTTAGAAGCCAATCAGAAAAAGGACTACAATTTAAAAATTTCCAAAACTAAC
GTTAGTTTTGGAAATTTTTAAATTGTAGTCCTTTTTCTGATTGGCTTCTAAACTGCTAACAGCACAGATAAATAAAAGGTTGCTTTGTTTTTTTCCCCCG[C/T]
AGCTGATCAGCCGTAGCTCAAATTGTCGTGAGTCCATGGTAAATAATGCATATTCCTTACACCATCAATTCTTAAGTTGTATTTTAATTTCTAATGGTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 39.00% | 0.02% | 4.99% | NA |
| All Indica | 2759 | 91.60% | 8.40% | 0.00% | 0.04% | NA |
| All Japonica | 1512 | 1.00% | 83.50% | 0.07% | 15.48% | NA |
| Aus | 269 | 23.40% | 76.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 4.90% | 0.00% | 0.17% | NA |
| Indica II | 465 | 85.80% | 14.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 71.60% | 0.13% | 27.12% | NA |
| Tropical Japonica | 504 | 0.60% | 99.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 1.20% | 88.40% | 0.00% | 10.37% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 61.10% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900591523 | G -> DEL | N | N | silent_mutation | Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 | N | N | N | N |
| vg0900591523 | G -> A | LOC_Os09g01850.1 | upstream_gene_variant ; 3947.0bp to feature; MODIFIER | silent_mutation | Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 | N | N | N | N |
| vg0900591523 | G -> A | LOC_Os09g01860.1 | downstream_gene_variant ; 1329.0bp to feature; MODIFIER | silent_mutation | Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 | N | N | N | N |
| vg0900591523 | G -> A | LOC_Os09g01870.1 | downstream_gene_variant ; 3777.0bp to feature; MODIFIER | silent_mutation | Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 | N | N | N | N |
| vg0900591523 | G -> A | LOC_Os09g01880.1 | downstream_gene_variant ; 4495.0bp to feature; MODIFIER | silent_mutation | Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 | N | N | N | N |
| vg0900591523 | G -> A | LOC_Os09g01850-LOC_Os09g01860 | intergenic_region ; MODIFIER | silent_mutation | Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900591523 | NA | 6.48E-18 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | NA | 9.26E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | NA | 2.08E-36 | mr1208_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | NA | 1.01E-06 | mr1402_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | 9.92E-06 | NA | mr1613_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | NA | 8.38E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | 4.01E-06 | 1.55E-06 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | NA | 5.03E-06 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | 6.12E-07 | 1.11E-08 | mr1795_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | NA | 2.69E-34 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900591523 | NA | 4.35E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |