\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900591523:

Variant ID: vg0900591523 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 591523
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.66, G: 0.34, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CGACCATTAGAAATTAAAATACAACTTAAGAATTGATGGTGTAAGGAATATGCATTATTTACCATGGACTCACGACAATTTGAGCTACGGCTGATCAGCT[G/A]
CGGGGGAAAAAAACAAAGCAACCTTTTATTTATCTGTGCTGTTAGCAGTTTAGAAGCCAATCAGAAAAAGGACTACAATTTAAAAATTTCCAAAACTAAC

Reverse complement sequence

GTTAGTTTTGGAAATTTTTAAATTGTAGTCCTTTTTCTGATTGGCTTCTAAACTGCTAACAGCACAGATAAATAAAAGGTTGCTTTGTTTTTTTCCCCCG[C/T]
AGCTGATCAGCCGTAGCTCAAATTGTCGTGAGTCCATGGTAAATAATGCATATTCCTTACACCATCAATTCTTAAGTTGTATTTTAATTTCTAATGGTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 39.00% 0.02% 4.99% NA
All Indica  2759 91.60% 8.40% 0.00% 0.04% NA
All Japonica  1512 1.00% 83.50% 0.07% 15.48% NA
Aus  269 23.40% 76.60% 0.00% 0.00% NA
Indica I  595 95.00% 4.90% 0.00% 0.17% NA
Indica II  465 85.80% 14.20% 0.00% 0.00% NA
Indica III  913 95.50% 4.50% 0.00% 0.00% NA
Indica Intermediate  786 87.90% 12.10% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 71.60% 0.13% 27.12% NA
Tropical Japonica  504 0.60% 99.20% 0.00% 0.20% NA
Japonica Intermediate  241 1.20% 88.40% 0.00% 10.37% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900591523 G -> DEL N N silent_mutation Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N
vg0900591523 G -> A LOC_Os09g01850.1 upstream_gene_variant ; 3947.0bp to feature; MODIFIER silent_mutation Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N
vg0900591523 G -> A LOC_Os09g01860.1 downstream_gene_variant ; 1329.0bp to feature; MODIFIER silent_mutation Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N
vg0900591523 G -> A LOC_Os09g01870.1 downstream_gene_variant ; 3777.0bp to feature; MODIFIER silent_mutation Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N
vg0900591523 G -> A LOC_Os09g01880.1 downstream_gene_variant ; 4495.0bp to feature; MODIFIER silent_mutation Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N
vg0900591523 G -> A LOC_Os09g01850-LOC_Os09g01860 intergenic_region ; MODIFIER silent_mutation Average:63.11; most accessible tissue: Zhenshan97 root, score: 87.735 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900591523 NA 6.48E-18 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 NA 9.26E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 NA 2.08E-36 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 NA 1.01E-06 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 9.92E-06 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 NA 8.38E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 4.01E-06 1.55E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 NA 5.03E-06 mr1758_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 6.12E-07 1.11E-08 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 NA 2.69E-34 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900591523 NA 4.35E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251