Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900590846:

Variant ID: vg0900590846 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 590846
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGGGCGCCAGCCTGGTCTTATATTTATCCAGCAGCGGCTGAATGTGGACCTTTTTTTTTTTTTAGCTTGGAGACCGTTAGATGGAGGCCGACATACTT[T/C]
ATCCGAAAGCCGGTTACGTTAGCGGGGAAGACTTATAGTATCTCTTGGAGGTCTATGCCAGTGCAATGAAAGGACGCAATTTGACTTTTCGATATGTTTA

Reverse complement sequence

TAAACATATCGAAAAGTCAAATTGCGTCCTTTCATTGCACTGGCATAGACCTCCAAGAGATACTATAAGTCTTCCCCGCTAACGTAACCGGCTTTCGGAT[A/G]
AAGTATGTCGGCCTCCATCTAACGGTCTCCAAGCTAAAAAAAAAAAAAGGTCCACATTCAGCCGCTGCTGGATAAATATAAGACCAGGCTGGCGCCCAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.70% 29.30% 0.04% 4.95% NA
All Indica  2759 97.40% 2.50% 0.00% 0.04% NA
All Japonica  1512 1.40% 83.10% 0.13% 15.34% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.10% 4.70% 0.00% 0.17% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 71.70% 0.13% 26.99% NA
Tropical Japonica  504 1.00% 98.80% 0.00% 0.20% NA
Japonica Intermediate  241 2.90% 86.70% 0.41% 9.96% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900590846 T -> DEL N N silent_mutation Average:71.754; most accessible tissue: Zhenshan97 root, score: 96.44 N N N N
vg0900590846 T -> C LOC_Os09g01850.1 upstream_gene_variant ; 3270.0bp to feature; MODIFIER silent_mutation Average:71.754; most accessible tissue: Zhenshan97 root, score: 96.44 N N N N
vg0900590846 T -> C LOC_Os09g01860.1 downstream_gene_variant ; 2006.0bp to feature; MODIFIER silent_mutation Average:71.754; most accessible tissue: Zhenshan97 root, score: 96.44 N N N N
vg0900590846 T -> C LOC_Os09g01870.1 downstream_gene_variant ; 4454.0bp to feature; MODIFIER silent_mutation Average:71.754; most accessible tissue: Zhenshan97 root, score: 96.44 N N N N
vg0900590846 T -> C LOC_Os09g01850-LOC_Os09g01860 intergenic_region ; MODIFIER silent_mutation Average:71.754; most accessible tissue: Zhenshan97 root, score: 96.44 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0900590846 T C -0.03 0.02 0.01 -0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900590846 NA 1.09E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 1.12E-22 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 6.86E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 1.49E-39 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 1.26E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 1.76E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 3.52E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 6.38E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 7.42E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 7.38E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 4.82E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 7.66E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 4.99E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 2.07E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 1.79E-06 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 5.01E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 1.95E-22 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 1.82E-07 NA mr1758_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 2.61E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 4.61E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 4.91E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 1.38E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900590846 NA 4.04E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251