\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900588490:

Variant ID: vg0900588490 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 588490
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.50, G: 0.49, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CAGCCAGCTCCCACTGAGATCGTCATCACGCCATCCCCCGGAGATCGCGAGAGCTGCCATGGACGTCGCCGGCGCTGCCGGCCGAGTGGTCCTCATCCTC[A/G]
CCAACTGATCACCATCTGCCGAAGATGGCCGTCCCCATGTCGCGTTGATGGAGCGTTGGGAATAGTCGGAGCAGCCACGGGCGCGCGTCGCCAAGCCATC

Reverse complement sequence

GATGGCTTGGCGACGCGCGCCCGTGGCTGCTCCGACTATTCCCAACGCTCCATCAACGCGACATGGGGACGGCCATCTTCGGCAGATGGTGATCAGTTGG[T/C]
GAGGATGAGGACCACTCGGCCGGCAGCGCCGGCGACGTCCATGGCAGCTCTCGCGATCTCCGGGGGATGGCGTGATGACGATCTCAGTGGGAGCTGGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 29.40% 3.51% 3.22% NA
All Indica  2759 97.20% 2.60% 0.00% 0.18% NA
All Japonica  1512 1.10% 83.50% 10.78% 4.63% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 95.00% 4.90% 0.00% 0.17% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.50% 1.40% 0.00% 0.11% NA
Indica Intermediate  786 96.60% 3.10% 0.00% 0.38% NA
Temperate Japonica  767 1.20% 72.40% 18.77% 7.69% NA
Tropical Japonica  504 0.60% 98.80% 0.00% 0.60% NA
Japonica Intermediate  241 1.70% 87.10% 7.88% 3.32% NA
VI/Aromatic  96 11.50% 14.60% 2.08% 71.88% NA
Intermediate  90 45.60% 45.60% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900588490 A -> G LOC_Os09g01850.1 upstream_gene_variant ; 914.0bp to feature; MODIFIER silent_mutation Average:79.632; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0900588490 A -> G LOC_Os09g01860.1 downstream_gene_variant ; 4362.0bp to feature; MODIFIER silent_mutation Average:79.632; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0900588490 A -> G LOC_Os09g01850-LOC_Os09g01860 intergenic_region ; MODIFIER silent_mutation Average:79.632; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N
vg0900588490 A -> DEL N N silent_mutation Average:79.632; most accessible tissue: Zhenshan97 young leaf, score: 87.004 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900588490 NA 4.41E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 5.29E-22 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 9.71E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 2.90E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 1.92E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 3.81E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 1.59E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 6.02E-21 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 2.27E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 3.14E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 1.75E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 8.78E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 1.19E-07 NA mr1008_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 3.62E-32 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 7.54E-22 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 5.22E-21 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 4.91E-52 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 5.03E-21 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 1.33E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 3.87E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 4.69E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 6.89E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900588490 NA 4.21E-24 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251