\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900549563:

Variant ID: vg0900549563 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 549563
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCTCGCTCGGTCGGCCGGTCGGGACGCGCGGCGTGCGCCGAATGGACGCCACGTTGCCAATCGCGGATCGACGGCTGCCACGCGCGTCGCGCGATAGC[A/G]
CTATACGAAAAAACCGAAGATTCGGTGCGGTTCGGCTCGGTTCTGTGCGGCCTACAGTTTTCGGTGATTTTCTGCCCAGCCTCGCTGCCGCAAAGAGACT

Reverse complement sequence

AGTCTCTTTGCGGCAGCGAGGCTGGGCAGAAAATCACCGAAAACTGTAGGCCGCACAGAACCGAGCCGAACCGCACCGAATCTTCGGTTTTTTCGTATAG[T/C]
GCTATCGCGCGACGCGCGTGGCAGCCGTCGATCCGCGATTGGCAACGTGGCGTCCATTCGGCGCACGCCGCGCGTCCCGACCGGCCGACCGAGCGAGCTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.60% 29.50% 0.00% 4.89% NA
All Indica  2759 97.40% 2.60% 0.00% 0.04% NA
All Japonica  1512 1.30% 83.50% 0.00% 15.15% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 95.00% 4.90% 0.00% 0.17% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.90% 3.10% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 71.80% 0.00% 26.99% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 88.40% 0.00% 9.13% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 52.20% 46.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900549563 A -> G LOC_Os09g01790.1 upstream_gene_variant ; 1954.0bp to feature; MODIFIER silent_mutation Average:65.071; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0900549563 A -> G LOC_Os09g01800.1 downstream_gene_variant ; 3322.0bp to feature; MODIFIER silent_mutation Average:65.071; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0900549563 A -> G LOC_Os09g01790-LOC_Os09g01800 intergenic_region ; MODIFIER silent_mutation Average:65.071; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0900549563 A -> DEL N N silent_mutation Average:65.071; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900549563 NA 2.01E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 2.20E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 6.09E-24 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.00E-41 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.17E-20 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 9.28E-49 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 2.72E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.95E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.02E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 6.44E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 5.05E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 6.63E-33 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.58E-21 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 5.02E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 4.51E-22 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 4.00E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 8.82E-08 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.29E-52 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 9.95E-08 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 8.62E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.11E-11 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 3.27E-19 mr1817_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 9.67E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 1.26E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 2.29E-08 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900549563 NA 8.16E-25 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251