\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900544466:

Variant ID: vg0900544466 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 544466
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTAAGAGATTTTTGTAAATTTTATATACTCCTATTCTGGCAGGAAAAATTCTCTTCGAATTGTCCTTGATATCAGCAGACAGAACAATTAATGCCAAT[T/C]
CACATGTGTTATTGTCCAGTGAGCCCATTGGTTTAACAGAGTTAGCAAGATCGCCAAGATAAATATAATATTCTCATGTATCAATGATCTTTAGGCTGCA

Reverse complement sequence

TGCAGCCTAAAGATCATTGATACATGAGAATATTATATTTATCTTGGCGATCTTGCTAACTCTGTTAAACCAATGGGCTCACTGGACAATAACACATGTG[A/G]
ATTGGCATTAATTGTTCTGTCTGCTGATATCAAGGACAATTCGAAGAGAATTTTTCCTGCCAGAATAGGAGTATATAAAATTTACAAAAATCTCTTACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 1.00% 0.21% 6.24% NA
All Indica  2759 99.30% 0.00% 0.07% 0.54% NA
All Japonica  1512 80.80% 2.80% 0.46% 15.87% NA
Aus  269 85.50% 0.00% 0.37% 14.13% NA
Indica I  595 99.70% 0.00% 0.00% 0.34% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.00% 0.00% 0.22% NA
Indica Intermediate  786 98.20% 0.10% 0.25% 1.40% NA
Temperate Japonica  767 69.40% 0.30% 0.52% 29.86% NA
Tropical Japonica  504 92.70% 6.70% 0.60% 0.00% NA
Japonica Intermediate  241 92.50% 2.90% 0.00% 4.56% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900544466 T -> DEL N N silent_mutation Average:25.095; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0900544466 T -> C LOC_Os09g01780.1 downstream_gene_variant ; 1486.0bp to feature; MODIFIER silent_mutation Average:25.095; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0900544466 T -> C LOC_Os09g01790.1 downstream_gene_variant ; 643.0bp to feature; MODIFIER silent_mutation Average:25.095; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N
vg0900544466 T -> C LOC_Os09g01780-LOC_Os09g01790 intergenic_region ; MODIFIER silent_mutation Average:25.095; most accessible tissue: Minghui63 flag leaf, score: 37.36 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900544466 4.14E-07 NA mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 6.17E-06 NA mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 1.48E-07 1.48E-07 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 7.82E-06 NA mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 NA 6.08E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 NA 7.90E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 6.97E-06 2.88E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 NA 1.10E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 NA 3.23E-06 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 3.95E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 7.59E-06 NA mr1233 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 NA 8.02E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 NA 3.80E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 2.09E-06 NA mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 NA 2.17E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 3.15E-06 NA mr1949 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 2.11E-06 NA mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900544466 6.81E-06 NA mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251