Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0900419284:

Variant ID: vg0900419284 (JBrowse)	Variation Type: INDEL
Chromosome: chr09	Position: 419284
Reference Allele: T	Alternative Allele: A,TA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

ATCCATTATAGAAAACCCTCTTCATTTCCTCTTCATTTTAGCCGTCTCAGCCAAAATATGAATTTTAAGTTTTTTGTAGAGTTGATTTTAAGTTTTTTTT[T/A,TA]
ATCTTTGGTTTATTTTCTAGTATTGGGTTTTACATAGCTAAGAACACATATATTAAAATTTTACTTACACGTTATATTTTGGACAATAATAAGTGTAACA

Reverse complement sequence

TGTTACACTTATTATTGTCCAAAATATAACGTGTAAGTAAAATTTTAATATATGTGTTCTTAGCTATGTAAAACCCAATACTAGAAAATAAACCAAAGAT[A/T,TA]
AAAAAAAACTTAAAATCAACTCTACAAAAAACTTAAAATTCATATTTTGGCTGAGACGGCTAAAATGAAGAGGAAATGAAGAGGGTTTTCTATAATGGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	5.20%	0.08%	0.00%	TA: 0.17%
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	83.10%	16.10%	0.26%	0.00%	TA: 0.53%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	68.20%	30.20%	0.52%	0.00%	TA: 1.04%
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900419284	T -> TA	LOC_Os09g01600.1	upstream_gene_variant ; 3010.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> TA	LOC_Os09g01600.2	upstream_gene_variant ; 3010.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> TA	LOC_Os09g01600.3	upstream_gene_variant ; 3010.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> TA	LOC_Os09g01600.4	upstream_gene_variant ; 3012.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> TA	LOC_Os09g01590.1	downstream_gene_variant ; 67.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> TA	LOC_Os09g01590-LOC_Os09g01600	intergenic_region ; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> A	LOC_Os09g01600.1	upstream_gene_variant ; 3011.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> A	LOC_Os09g01600.2	upstream_gene_variant ; 3011.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> A	LOC_Os09g01600.3	upstream_gene_variant ; 3011.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> A	LOC_Os09g01600.4	upstream_gene_variant ; 3013.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> A	LOC_Os09g01590.1	downstream_gene_variant ; 66.0bp to feature; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N
vg0900419284	T -> A	LOC_Os09g01590-LOC_Os09g01600	intergenic_region ; MODIFIER	silent_mutation	Average:74.687; most accessible tissue: Callus, score: 83.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900419284	NA	2.19E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	4.51E-06	NA	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	NA	2.51E-08	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	NA	1.16E-06	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	NA	6.88E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	7.32E-06	NA	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	NA	1.25E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	8.89E-07	NA	mr1765	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	NA	3.48E-09	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	NA	1.46E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284	NA	7.62E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251