\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900419284:

Variant ID: vg0900419284 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 419284
Reference Allele: TAlternative Allele: A,TA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCATTATAGAAAACCCTCTTCATTTCCTCTTCATTTTAGCCGTCTCAGCCAAAATATGAATTTTAAGTTTTTTGTAGAGTTGATTTTAAGTTTTTTTT[T/A,TA]
ATCTTTGGTTTATTTTCTAGTATTGGGTTTTACATAGCTAAGAACACATATATTAAAATTTTACTTACACGTTATATTTTGGACAATAATAAGTGTAACA

Reverse complement sequence

TGTTACACTTATTATTGTCCAAAATATAACGTGTAAGTAAAATTTTAATATATGTGTTCTTAGCTATGTAAAACCCAATACTAGAAAATAAACCAAAGAT[A/T,TA]
AAAAAAAACTTAAAATCAACTCTACAAAAAACTTAAAATTCATATTTTGGCTGAGACGGCTAAAATGAAGAGGAAATGAAGAGGGTTTTCTATAATGGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.20% 0.08% 0.00% TA: 0.17%
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 83.10% 16.10% 0.26% 0.00% TA: 0.53%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 68.20% 30.20% 0.52% 0.00% TA: 1.04%
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900419284 T -> TA LOC_Os09g01600.1 upstream_gene_variant ; 3010.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> TA LOC_Os09g01600.2 upstream_gene_variant ; 3010.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> TA LOC_Os09g01600.3 upstream_gene_variant ; 3010.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> TA LOC_Os09g01600.4 upstream_gene_variant ; 3012.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> TA LOC_Os09g01590.1 downstream_gene_variant ; 67.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> TA LOC_Os09g01590-LOC_Os09g01600 intergenic_region ; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> A LOC_Os09g01600.1 upstream_gene_variant ; 3011.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> A LOC_Os09g01600.2 upstream_gene_variant ; 3011.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> A LOC_Os09g01600.3 upstream_gene_variant ; 3011.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> A LOC_Os09g01600.4 upstream_gene_variant ; 3013.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> A LOC_Os09g01590.1 downstream_gene_variant ; 66.0bp to feature; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N
vg0900419284 T -> A LOC_Os09g01590-LOC_Os09g01600 intergenic_region ; MODIFIER silent_mutation Average:74.687; most accessible tissue: Callus, score: 83.653 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900419284 NA 2.19E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 4.51E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 NA 2.51E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 NA 1.16E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 NA 6.88E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 7.32E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 NA 1.25E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 8.89E-07 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 NA 3.48E-09 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 NA 1.46E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900419284 NA 7.62E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251