| Variant ID: vg0900419284 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr09 | Position: 419284 |
| Reference Allele: T | Alternative Allele: A,TA |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 123. )
ATCCATTATAGAAAACCCTCTTCATTTCCTCTTCATTTTAGCCGTCTCAGCCAAAATATGAATTTTAAGTTTTTTGTAGAGTTGATTTTAAGTTTTTTTT[T/A,TA]
ATCTTTGGTTTATTTTCTAGTATTGGGTTTTACATAGCTAAGAACACATATATTAAAATTTTACTTACACGTTATATTTTGGACAATAATAAGTGTAACA
TGTTACACTTATTATTGTCCAAAATATAACGTGTAAGTAAAATTTTAATATATGTGTTCTTAGCTATGTAAAACCCAATACTAGAAAATAAACCAAAGAT[A/T,TA]
AAAAAAAACTTAAAATCAACTCTACAAAAAACTTAAAATTCATATTTTGGCTGAGACGGCTAAAATGAAGAGGAAATGAAGAGGGTTTTCTATAATGGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 5.20% | 0.08% | 0.00% | TA: 0.17% |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 83.10% | 16.10% | 0.26% | 0.00% | TA: 0.53% |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.20% | 30.20% | 0.52% | 0.00% | TA: 1.04% |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900419284 | T -> TA | LOC_Os09g01600.1 | upstream_gene_variant ; 3010.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> TA | LOC_Os09g01600.2 | upstream_gene_variant ; 3010.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> TA | LOC_Os09g01600.3 | upstream_gene_variant ; 3010.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> TA | LOC_Os09g01600.4 | upstream_gene_variant ; 3012.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> TA | LOC_Os09g01590.1 | downstream_gene_variant ; 67.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> TA | LOC_Os09g01590-LOC_Os09g01600 | intergenic_region ; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> A | LOC_Os09g01600.1 | upstream_gene_variant ; 3011.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> A | LOC_Os09g01600.2 | upstream_gene_variant ; 3011.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> A | LOC_Os09g01600.3 | upstream_gene_variant ; 3011.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> A | LOC_Os09g01600.4 | upstream_gene_variant ; 3013.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> A | LOC_Os09g01590.1 | downstream_gene_variant ; 66.0bp to feature; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| vg0900419284 | T -> A | LOC_Os09g01590-LOC_Os09g01600 | intergenic_region ; MODIFIER | silent_mutation | Average:74.687; most accessible tissue: Callus, score: 83.653 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900419284 | NA | 2.19E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | 4.51E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | NA | 2.51E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | NA | 1.16E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | NA | 6.88E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | 7.32E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | NA | 1.25E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | 8.89E-07 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | NA | 3.48E-09 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | NA | 1.46E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900419284 | NA | 7.62E-07 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |