\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900341874:

Variant ID: vg0900341874 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 341874
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCCACCGCCACTAGCCGAGAGAGAGGATACGAGAGATGAATAGATAGGGTTGCTTCAAGGGTATTATGGTCATTATGAAAAGTTATTATATTTCTTTT[C/T]
TTTTTGAAAAGTAGGATCAAATAAGCAATCTAAAAAAGTACGATCAGATTAGTAGTTAGGTTTCGAAATAGGGCCTAATAAGCATTTATCCCACATATAT

Reverse complement sequence

ATATATGTGGGATAAATGCTTATTAGGCCCTATTTCGAAACCTAACTACTAATCTGATCGTACTTTTTTAGATTGCTTATTTGATCCTACTTTTCAAAAA[G/A]
AAAAGAAATATAATAACTTTTCATAATGACCATAATACCCTTGAAGCAACCCTATCTATTCATCTCTCGTATCCTCTCTCTCGGCTAGTGGCGGTGGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 19.40% 5.76% 0.04% NA
All Indica  2759 64.30% 32.70% 2.97% 0.00% NA
All Japonica  1512 87.20% 0.30% 12.37% 0.13% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 64.50% 30.90% 4.54% 0.00% NA
Indica II  465 79.60% 17.60% 2.80% 0.00% NA
Indica III  913 59.00% 38.90% 2.08% 0.00% NA
Indica Intermediate  786 61.30% 35.80% 2.93% 0.00% NA
Temperate Japonica  767 76.40% 0.10% 23.21% 0.26% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 0.40% 3.73% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900341874 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900341874 C -> T LOC_Os09g01450.1 upstream_gene_variant ; 2238.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900341874 C -> T LOC_Os09g01460.1 upstream_gene_variant ; 1079.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900341874 C -> T LOC_Os09g01470.1 upstream_gene_variant ; 2729.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0900341874 C -> T LOC_Os09g01460-LOC_Os09g01470 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900341874 4.07E-06 4.07E-06 mr1249 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900341874 NA 1.14E-06 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900341874 NA 2.81E-07 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251