\
| Variant ID: vg0900341874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 341874 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 124. )
TTGCCACCGCCACTAGCCGAGAGAGAGGATACGAGAGATGAATAGATAGGGTTGCTTCAAGGGTATTATGGTCATTATGAAAAGTTATTATATTTCTTTT[C/T]
TTTTTGAAAAGTAGGATCAAATAAGCAATCTAAAAAAGTACGATCAGATTAGTAGTTAGGTTTCGAAATAGGGCCTAATAAGCATTTATCCCACATATAT
ATATATGTGGGATAAATGCTTATTAGGCCCTATTTCGAAACCTAACTACTAATCTGATCGTACTTTTTTAGATTGCTTATTTGATCCTACTTTTCAAAAA[G/A]
AAAAGAAATATAATAACTTTTCATAATGACCATAATACCCTTGAAGCAACCCTATCTATTCATCTCTCGTATCCTCTCTCTCGGCTAGTGGCGGTGGCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.80% | 19.40% | 5.76% | 0.04% | NA |
| All Indica | 2759 | 64.30% | 32.70% | 2.97% | 0.00% | NA |
| All Japonica | 1512 | 87.20% | 0.30% | 12.37% | 0.13% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 64.50% | 30.90% | 4.54% | 0.00% | NA |
| Indica II | 465 | 79.60% | 17.60% | 2.80% | 0.00% | NA |
| Indica III | 913 | 59.00% | 38.90% | 2.08% | 0.00% | NA |
| Indica Intermediate | 786 | 61.30% | 35.80% | 2.93% | 0.00% | NA |
| Temperate Japonica | 767 | 76.40% | 0.10% | 23.21% | 0.26% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 0.40% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900341874 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0900341874 | C -> T | LOC_Os09g01450.1 | upstream_gene_variant ; 2238.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0900341874 | C -> T | LOC_Os09g01460.1 | upstream_gene_variant ; 1079.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0900341874 | C -> T | LOC_Os09g01470.1 | upstream_gene_variant ; 2729.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0900341874 | C -> T | LOC_Os09g01460-LOC_Os09g01470 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900341874 | 4.07E-06 | 4.07E-06 | mr1249 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900341874 | NA | 1.14E-06 | mr1063_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900341874 | NA | 2.81E-07 | mr1260_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |