Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900318728:

Variant ID: vg0900318728 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 318728
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

GCTAGAGAAAAGCTACACTACAAGCCCAGCCGTTGCCCACGCTGGCTTGTGATAAGTATGAGGAATTCTTCCAGGGTTTCCCGCGAACCGGTCCTTAATT[A/G]
CCATGGGTGCGACTAGCAAAACCATGCACCCACGGCCCACCATGTGATTCATTTTAATTAACCAACACCAAAGCGGTGGTACTAATCCAACATTACCATT

Reverse complement sequence

AATGGTAATGTTGGATTAGTACCACCGCTTTGGTGTTGGTTAATTAAAATGAATCACATGGTGGGCCGTGGGTGCATGGTTTTGCTAGTCGCACCCATGG[T/C]
AATTAAGGACCGGTTCGCGGGAAACCCTGGAAGAATTCCTCATACTTATCACAAGCCAGCGTGGGCAACGGCTGGGCTTGTAGTGTAGCTTTTCTCTAGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	0.30%	6.56%	22.64%	NA
All Indica	2759	60.80%	0.40%	9.06%	29.76%	NA
All Japonica	1512	85.30%	0.00%	0.13%	14.55%	NA
Aus	269	70.60%	1.10%	21.56%	6.69%	NA
Indica I	595	53.90%	0.30%	12.77%	32.94%	NA
Indica II	465	49.50%	0.00%	6.02%	44.52%	NA
Indica III	913	68.20%	0.40%	8.43%	22.89%	NA
Indica Intermediate	786	64.00%	0.60%	8.78%	26.59%	NA
Temperate Japonica	767	72.10%	0.00%	0.26%	27.64%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	97.10%	0.00%	0.00%	2.90%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	87.80%	0.00%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900318728	A -> G	LOC_Os09g01410.1	upstream_gene_variant ; 1382.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900318728	A -> G	LOC_Os09g01400.1	downstream_gene_variant ; 857.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900318728	A -> G	LOC_Os09g01420.1	downstream_gene_variant ; 4706.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900318728	A -> G	LOC_Os09g01400-LOC_Os09g01410	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900318728	A -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900318728	NA	2.22E-06	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	3.99E-12	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	1.18E-06	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	8.06E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	3.84E-13	mr1335	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	3.82E-07	mr1335	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	1.96E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	1.06E-08	mr1680	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	7.66E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	2.93E-06	8.08E-07	mr1755	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	4.82E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	4.35E-09	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	5.11E-09	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	6.54E-08	mr1727_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	1.49E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	8.31E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900318728	NA	4.09E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251