\
| Variant ID: vg0900280849 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 280849 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 113. )
TACTTTCGCAGTTTTCTGGGTGTTTCTTTATCTCCGGATTTTTTGCCATCGTCGCCTTCGTCGTCGCTCAGCACTAATTTCCTCTTGCGGGAATCTGACT[T/G]
CCCGGCTGGATTAGAGGTGTTAGGCTGGGGTTCGGGCCTAATTTTCGGTCCCCCGCTCCCCTGAACGGTTTGACGGCGAGGTGATCGGCGCTGAGCAATT
AATTGCTCAGCGCCGATCACCTCGCCGTCAAACCGTTCAGGGGAGCGGGGGACCGAAAATTAGGCCCGAACCCCAGCCTAACACCTCTAATCCAGCCGGG[A/C]
AGTCAGATTCCCGCAAGAGGAAATTAGTGCTGAGCGACGACGAAGGCGACGATGGCAAAAAATCCGGAGATAAAGAAACACCCAGAAAACTGCGAAAGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.60% | 11.00% | 1.08% | 53.28% | NA |
| All Indica | 2759 | 7.90% | 18.60% | 1.38% | 72.13% | NA |
| All Japonica | 1512 | 83.10% | 0.10% | 0.26% | 16.47% | NA |
| Aus | 269 | 4.50% | 0.70% | 2.60% | 92.19% | NA |
| Indica I | 595 | 13.90% | 1.20% | 2.02% | 82.86% | NA |
| Indica II | 465 | 7.10% | 32.00% | 1.08% | 59.78% | NA |
| Indica III | 913 | 2.60% | 21.50% | 1.31% | 74.59% | NA |
| Indica Intermediate | 786 | 9.80% | 20.60% | 1.15% | 68.45% | NA |
| Temperate Japonica | 767 | 69.10% | 0.30% | 0.39% | 30.25% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.00% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 64.40% | 3.30% | 2.22% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900280849 | T -> G | LOC_Os09g01350.1 | missense_variant ; p.Lys339Gln; MODERATE | nonsynonymous_codon ; K339Q | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
-0.99 |
TOLERATED | 1.00 |
| vg0900280849 | T -> DEL | LOC_Os09g01350.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900280849 | NA | 1.60E-08 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | 1.94E-07 | 2.56E-10 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | 1.71E-07 | 2.43E-10 | mr1009 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | NA | 1.34E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | NA | 7.11E-12 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | NA | 7.24E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | NA | 2.53E-06 | mr1008_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | NA | 1.16E-07 | mr1749_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | NA | 2.80E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900280849 | NA | 6.18E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |