\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900280117:

Variant ID: vg0900280117 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 280117
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCTTTTTCAGCTGGCACACTTCTTCATCCTCTTTCTGCCGGTTTATTATAATGCCTTCAGGCCGCAAGTCATCATCCCACCACTTGACTAGAATGGGA[A/G]
GGCGTGAGTCTTCAGCCGCTCGTATCCGGGGAATTTCCTCTTCGTCACCGACCAGTGGTCCTGATGCATCCATGGATGAAAGTCAGACAATCAATTGAAG

Reverse complement sequence

CTTCAATTGATTGTCTGACTTTCATCCATGGATGCATCAGGACCACTGGTCGGTGACGAAGAGGAAATTCCCCGGATACGAGCGGCTGAAGACTCACGCC[T/C]
TCCCATTCTAGTCAAGTGGTGGGATGATGACTTGCGGCCTGAAGGCATTATAATAAACCGGCAGAAAGAGGATGAAGAAGTGTGCCAGCTGAAAAAGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.20% 33.90% 2.35% 24.57% NA
All Indica  2759 61.50% 6.60% 3.41% 28.42% NA
All Japonica  1512 0.70% 83.20% 0.26% 15.87% NA
Aus  269 48.00% 3.70% 3.35% 44.98% NA
Indica I  595 46.60% 12.60% 8.24% 32.61% NA
Indica II  465 72.70% 5.80% 1.29% 20.22% NA
Indica III  913 69.90% 2.50% 0.77% 26.83% NA
Indica Intermediate  786 56.60% 7.40% 4.07% 31.93% NA
Temperate Japonica  767 1.00% 69.10% 0.52% 29.34% NA
Tropical Japonica  504 0.00% 99.60% 0.00% 0.40% NA
Japonica Intermediate  241 0.80% 93.80% 0.00% 5.39% NA
VI/Aromatic  96 0.00% 95.80% 0.00% 4.17% NA
Intermediate  90 17.80% 64.40% 4.44% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0900280117 A -> G LOC_Os09g01350.1 missense_variant ; p.Leu522Pro; MODERATE nonsynonymous_codon ; L522P Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 probably damaging -2.204 TOLERATED 1.00
vg0900280117 A -> DEL LOC_Os09g01350.1 N frameshift_variant Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0900280117 A G 0.0 0.0 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0900280117 NA 6.19E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900280117 NA 2.76E-25 mr1051_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900280117 NA 5.20E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900280117 6.78E-07 NA mr1954_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900280117 NA 5.24E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251