\
| Variant ID: vg0900240275 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 240275 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCTTGACAGAAAAGCTACGTAGATAACCGCCGAAGGGAGCTTGCTTTTGAAGCAGGGGATTATGTGTATCTCCATGTCACTCCGCTCAGGGGAGTACACC[A/G]
TTTCCAAACCAAAGGAAAGTTGGCACCACGCTTTGTGGGACCATATTGGATTTTGGAACGCAGGGGTGAAGTTGCTTACCAGCTTGAGCTTCCCTCCAAC
GTTGGAGGGAAGCTCAAGCTGGTAAGCAACTTCACCCCTGCGTTCCAAAATCCAATATGGTCCCACAAAGCGTGGTGCCAACTTTCCTTTGGTTTGGAAA[T/C]
GGTGTACTCCCCTGAGCGGAGTGACATGGAGATACACATAATCCCCTGCTTCAAAAGCAAGCTCCCTTCGGCGGTTATCTACGTAGCTTTTCTGTCAAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.10% | 4.00% | 28.23% | 30.70% | NA |
| All Indica | 2759 | 7.00% | 5.80% | 39.14% | 48.13% | NA |
| All Japonica | 1512 | 91.60% | 0.40% | 6.81% | 1.19% | NA |
| Aus | 269 | 9.70% | 7.80% | 51.67% | 30.86% | NA |
| Indica I | 595 | 9.40% | 0.70% | 36.64% | 53.28% | NA |
| Indica II | 465 | 4.90% | 4.90% | 37.20% | 52.90% | NA |
| Indica III | 913 | 4.60% | 9.90% | 43.81% | 41.73% | NA |
| Indica Intermediate | 786 | 9.00% | 5.30% | 36.77% | 48.85% | NA |
| Temperate Japonica | 767 | 86.40% | 0.80% | 12.39% | 0.39% | NA |
| Tropical Japonica | 504 | 97.20% | 0.00% | 0.40% | 2.38% | NA |
| Japonica Intermediate | 241 | 96.30% | 0.00% | 2.49% | 1.24% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 63.30% | 4.40% | 12.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900240275 | A -> G | LOC_Os09g01280.1 | missense_variant ; p.His430Arg; MODERATE | nonsynonymous_codon ; H430R | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
-0.86 |
TOLERATED | 1.00 |
| vg0900240275 | A -> DEL | LOC_Os09g01280.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900240275 | NA | 1.58E-16 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 6.90E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | 1.72E-07 | 1.72E-07 | mr1166 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 3.86E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 1.65E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | 6.66E-06 | 6.66E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 1.59E-06 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 1.21E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 3.80E-08 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 5.21E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 1.49E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | 5.09E-06 | 5.09E-06 | mr1649 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900240275 | NA | 1.85E-09 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |