Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0900126135:

Variant ID: vg0900126135 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 126135
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATAAAGGGAATAAGTTAGAGTAAATTGGAAAGGTTCTAATAATACTTGAACCAATTTTTAAATAAACATGAAATAGATTTTTGAACCACACAATTTAAT[C/T]
AAAAGACAGCATGATGCAGTCAAATTTTAGTTTAAAATTTGAGGATGTTACAAACCTACCCCCTTAAAGAAATCTCGTCCCGAGATTTACTTAAGAGTCT

Reverse complement sequence

AGACTCTTAAGTAAATCTCGGGACGAGATTTCTTTAAGGGGGTAGGTTTGTAACATCCTCAAATTTTAAACTAAAATTTGACTGCATCATGCTGTCTTTT[G/A]
ATTAAATTGTGTGGTTCAAAAATCTATTTCATGTTTATTTAAAAATTGGTTCAAGTATTATTAGAACCTTTCCAATTTACTCTAACTTATTCCCTTTATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.70%	0.10%	10.28%	46.93%	NA
All Indica	2759	17.60%	0.10%	11.85%	70.46%	NA
All Japonica	1512	95.00%	0.00%	1.65%	3.37%	NA
Aus	269	7.40%	0.40%	37.55%	54.65%	NA
Indica I	595	32.30%	0.20%	13.28%	54.29%	NA
Indica II	465	24.50%	0.20%	13.55%	61.72%	NA
Indica III	913	2.10%	0.00%	10.19%	87.73%	NA
Indica Intermediate	786	20.40%	0.10%	11.70%	67.81%	NA
Temperate Japonica	767	91.90%	0.00%	3.00%	5.08%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	95.00%	0.00%	0.41%	4.56%	NA
VI/Aromatic	96	26.00%	0.00%	21.88%	52.08%	NA
Intermediate	90	57.80%	0.00%	13.33%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0900126135	C -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900126135	C -> T	LOC_Os09g01120.1	downstream_gene_variant ; 559.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0900126135	C -> T	LOC_Os09g01110-LOC_Os09g01120	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0900126135	NA	2.04E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900126135	9.68E-06	9.68E-06	mr1396	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900126135	NA	5.87E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900126135	NA	3.21E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0900126135	NA	4.74E-20	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251