\
| Variant ID: vg0900043120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 43120 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 200. )
TTCGACCAAGCTCTTTGTGATCTTGGAGCAAGTGTCAGCGTCATGCCCAAAGACGTCTTGGACAAGCTCAACTTCACGGTGTTGGCACCAACACCGATGC[G/A]
CCTAATATTGGCTGACTCATCAGTCCGTTACCCAGCAGGAATAGCGGAAGATGTGCCAGTCAAGATACGGGATTTCTTCATCCCAGTTGACTTCGTGGTG
CACCACGAAGTCAACTGGGATGAAGAAATCCCGTATCTTGACTGGCACATCTTCCGCTATTCCTGCTGGGTAACGGACTGATGAGTCAGCCAATATTAGG[C/T]
GCATCGGTGTTGGTGCCAACACCGTGAAGTTGAGCTTGTCCAAGACGTCTTTGGGCATGACGCTGACACTTGCTCCAAGATCACAAAGAGCTTGGTCGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.70% | 34.00% | 2.96% | 14.30% | NA |
| All Indica | 2759 | 34.50% | 54.10% | 2.94% | 8.48% | NA |
| All Japonica | 1512 | 73.10% | 0.60% | 3.04% | 23.21% | NA |
| Aus | 269 | 66.90% | 32.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 41.20% | 45.70% | 2.52% | 10.59% | NA |
| Indica II | 465 | 42.80% | 43.90% | 4.30% | 9.03% | NA |
| Indica III | 913 | 29.10% | 61.40% | 2.85% | 6.57% | NA |
| Indica Intermediate | 786 | 30.80% | 57.90% | 2.54% | 8.78% | NA |
| Temperate Japonica | 767 | 57.90% | 0.70% | 5.08% | 36.38% | NA |
| Tropical Japonica | 504 | 96.60% | 0.20% | 0.20% | 2.98% | NA |
| Japonica Intermediate | 241 | 72.60% | 1.20% | 2.49% | 23.65% | NA |
| VI/Aromatic | 96 | 14.60% | 5.20% | 5.21% | 75.00% | NA |
| Intermediate | 90 | 55.60% | 17.80% | 8.89% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0900043120 | G -> DEL | LOC_Os09g01006.1 | N | frameshift_variant | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0900043120 | G -> A | LOC_Os09g01006.1 | missense_variant ; p.Arg81His; MODERATE | nonsynonymous_codon ; R81H | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
0.672 |
TOLERATED | 0.60 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0900043120 | 4.72E-06 | NA | mr1168 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | 1.85E-06 | 6.01E-08 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | 1.81E-06 | 6.03E-08 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | NA | 2.02E-13 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | 6.78E-06 | 6.77E-06 | mr1449 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | NA | 1.98E-06 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | NA | 4.58E-07 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | 2.20E-06 | NA | mr1168_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | 1.68E-06 | 1.60E-09 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0900043120 | NA | 1.04E-07 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |