\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828438790:

Variant ID: vg0828438790 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28438790
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTACCTCACCCGGATGTGCTTGCTCCGTTCGTGAACGAGAGCAAGTTCCTCGAGCTCTACTCTAGGATCGGGATGGCCCAACTTTCTCACAAGACGACG[T/C]
CCAAGACTTGGGGGGAGAATGATGGAATAAGTCTTGTGGCGCGGAGGGGCCGAACCTCGTGCGGGCGAGGCTGTCGGTGACGGAGGTGTCCTCCATCTCA

Reverse complement sequence

TGAGATGGAGGACACCTCCGTCACCGACAGCCTCGCCCGCACGAGGTTCGGCCCCTCCGCGCCACAAGACTTATTCCATCATTCTCCCCCCAAGTCTTGG[A/G]
CGTCGTCTTGTGAGAAAGTTGGGCCATCCCGATCCTAGAGTAGAGCTCGAGGAACTTGCTCTCGTTCACGAACGGAGCAAGCACATCCGGGTGAGGTACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 2.20% 11.40% 24.14% NA
All Indica  2759 38.50% 3.60% 18.88% 39.04% NA
All Japonica  1512 96.40% 0.00% 0.93% 2.65% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 63.00% 0.30% 15.13% 21.51% NA
Indica II  465 31.40% 12.70% 13.33% 42.58% NA
Indica III  913 26.90% 0.10% 24.53% 48.41% NA
Indica Intermediate  786 37.50% 4.70% 18.45% 39.31% NA
Temperate Japonica  767 97.90% 0.00% 0.39% 1.69% NA
Tropical Japonica  504 98.00% 0.00% 0.40% 1.59% NA
Japonica Intermediate  241 88.40% 0.00% 3.73% 7.88% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 66.70% 3.30% 3.33% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828438790 T -> C LOC_Os08g45270.1 downstream_gene_variant ; 3016.0bp to feature; MODIFIER silent_mutation Average:16.554; most accessible tissue: Callus, score: 59.687 N N N N
vg0828438790 T -> C LOC_Os08g45280.1 intron_variant ; MODIFIER silent_mutation Average:16.554; most accessible tissue: Callus, score: 59.687 N N N N
vg0828438790 T -> DEL N N silent_mutation Average:16.554; most accessible tissue: Callus, score: 59.687 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828438790 NA 7.41E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 8.86E-07 8.86E-07 mr1377 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 6.34E-07 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 3.89E-09 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 1.37E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 7.56E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 1.76E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 5.48E-10 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 5.89E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828438790 NA 8.54E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251