\
| Variant ID: vg0828438790 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 28438790 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGTACCTCACCCGGATGTGCTTGCTCCGTTCGTGAACGAGAGCAAGTTCCTCGAGCTCTACTCTAGGATCGGGATGGCCCAACTTTCTCACAAGACGACG[T/C]
CCAAGACTTGGGGGGAGAATGATGGAATAAGTCTTGTGGCGCGGAGGGGCCGAACCTCGTGCGGGCGAGGCTGTCGGTGACGGAGGTGTCCTCCATCTCA
TGAGATGGAGGACACCTCCGTCACCGACAGCCTCGCCCGCACGAGGTTCGGCCCCTCCGCGCCACAAGACTTATTCCATCATTCTCCCCCCAAGTCTTGG[A/G]
CGTCGTCTTGTGAGAAAGTTGGGCCATCCCGATCCTAGAGTAGAGCTCGAGGAACTTGCTCTCGTTCACGAACGGAGCAAGCACATCCGGGTGAGGTACC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.30% | 2.20% | 11.40% | 24.14% | NA |
| All Indica | 2759 | 38.50% | 3.60% | 18.88% | 39.04% | NA |
| All Japonica | 1512 | 96.40% | 0.00% | 0.93% | 2.65% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.00% | 0.30% | 15.13% | 21.51% | NA |
| Indica II | 465 | 31.40% | 12.70% | 13.33% | 42.58% | NA |
| Indica III | 913 | 26.90% | 0.10% | 24.53% | 48.41% | NA |
| Indica Intermediate | 786 | 37.50% | 4.70% | 18.45% | 39.31% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 0.39% | 1.69% | NA |
| Tropical Japonica | 504 | 98.00% | 0.00% | 0.40% | 1.59% | NA |
| Japonica Intermediate | 241 | 88.40% | 0.00% | 3.73% | 7.88% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 3.30% | 3.33% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0828438790 | T -> C | LOC_Os08g45270.1 | downstream_gene_variant ; 3016.0bp to feature; MODIFIER | silent_mutation | Average:16.554; most accessible tissue: Callus, score: 59.687 | N | N | N | N |
| vg0828438790 | T -> C | LOC_Os08g45280.1 | intron_variant ; MODIFIER | silent_mutation | Average:16.554; most accessible tissue: Callus, score: 59.687 | N | N | N | N |
| vg0828438790 | T -> DEL | N | N | silent_mutation | Average:16.554; most accessible tissue: Callus, score: 59.687 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0828438790 | NA | 7.41E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | 8.86E-07 | 8.86E-07 | mr1377 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 6.34E-07 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 3.89E-09 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 1.37E-09 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 7.56E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 1.76E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 5.48E-10 | mr1889_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 5.89E-07 | mr1896_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828438790 | NA | 8.54E-08 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |