\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828401472:

Variant ID: vg0828401472 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28401472
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAGTACTGCAAGTACAACCCATCAATCAGCCCATTCCAATGGTAAGCACTAAAGCATGAATTACACAATACTTCAGATAAAGCAGCTTGTGCACATT[G/C,T]
AAAAGGGTTAAAGTTGACAAAAAAATTATCATGCACTAAAACTAGAAATAAACAAAACAGCATTTTTAATTTCCTGGTCCTAAGTCCTAACTGGAATCAA

Reverse complement sequence

TTGATTCCAGTTAGGACTTAGGACCAGGAAATTAAAAATGCTGTTTTGTTTATTTCTAGTTTTAGTGCATGATAATTTTTTTGTCAACTTTAACCCTTTT[C/G,A]
AATGTGCACAAGCTGCTTTATCTGAAGTATTGTGTAATTCATGCTTTAGTGCTTACCATTGGAATGGGCTGATTGATGGGTTGTACTTGCAGTACTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 4.90% 0.53% 0.00% T: 0.04%
All Indica  2759 99.80% 0.00% 0.07% 0.00% T: 0.07%
All Japonica  1512 83.70% 14.80% 1.52% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.00% 0.00% T: 0.34%
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.10% 0.25% 0.00% NA
Temperate Japonica  767 96.10% 2.70% 1.17% 0.00% NA
Tropical Japonica  504 63.10% 34.90% 1.98% 0.00% NA
Japonica Intermediate  241 87.10% 11.20% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828401472 G -> C LOC_Os08g45220.1 downstream_gene_variant ; 2385.0bp to feature; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> C LOC_Os08g45230.1 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> C LOC_Os08g45220.2 downstream_gene_variant ; 2385.0bp to feature; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> C LOC_Os08g45240.2 intron_variant ; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> C LOC_Os08g45240.1 intron_variant ; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> C LOC_Os08g45240.4 intron_variant ; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> T LOC_Os08g45220.1 downstream_gene_variant ; 2385.0bp to feature; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> T LOC_Os08g45230.1 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> T LOC_Os08g45220.2 downstream_gene_variant ; 2385.0bp to feature; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> T LOC_Os08g45240.2 intron_variant ; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> T LOC_Os08g45240.1 intron_variant ; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N
vg0828401472 G -> T LOC_Os08g45240.4 intron_variant ; MODIFIER silent_mutation Average:63.83; most accessible tissue: Callus, score: 85.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828401472 5.38E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.86E-06 NA mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 7.31E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 3.39E-07 NA mr1104 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 3.67E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 8.38E-08 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 6.31E-06 NA mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 6.73E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.51E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.93E-06 NA mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 1.09E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 9.76E-06 NA mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 1.45E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 3.96E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 4.77E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 3.32E-07 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 3.78E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 1.70E-07 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.12E-07 NA mr1070_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 6.64E-06 NA mr1070_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 4.88E-08 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.96E-14 NA mr1083_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 3.22E-09 NA mr1083_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.38E-10 NA mr1085_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.41E-08 NA mr1085_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.88E-06 NA mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 3.15E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.11E-10 NA mr1103_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.24E-06 NA mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 7.51E-18 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.36E-10 6.75E-06 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 3.41E-14 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.34E-08 NA mr1107_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 4.56E-09 NA mr1145_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 4.25E-12 NA mr1155_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.73E-09 1.12E-08 mr1155_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 2.78E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 3.77E-16 NA mr1226_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 3.42E-08 NA mr1226_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.07E-06 NA mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 1.67E-06 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 1.92E-06 NA mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 2.80E-09 NA mr1408_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 8.97E-08 NA mr1408_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 6.11E-08 NA mr1437_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 3.36E-06 NA mr1437_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 6.25E-06 NA mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 3.00E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 2.39E-13 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 6.23E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 NA 3.13E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472 3.46E-06 NA mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251