Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828401472:

Variant ID: vg0828401472 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 28401472
Reference Allele: G	Alternative Allele: C,T
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAAGTACTGCAAGTACAACCCATCAATCAGCCCATTCCAATGGTAAGCACTAAAGCATGAATTACACAATACTTCAGATAAAGCAGCTTGTGCACATT[G/C,T]
AAAAGGGTTAAAGTTGACAAAAAAATTATCATGCACTAAAACTAGAAATAAACAAAACAGCATTTTTAATTTCCTGGTCCTAAGTCCTAACTGGAATCAA

Reverse complement sequence

TTGATTCCAGTTAGGACTTAGGACCAGGAAATTAAAAATGCTGTTTTGTTTATTTCTAGTTTTAGTGCATGATAATTTTTTTGTCAACTTTAACCCTTTT[C/G,A]
AATGTGCACAAGCTGCTTTATCTGAAGTATTGTGTAATTCATGCTTTAGTGCTTACCATTGGAATGGGCTGATTGATGGGTTGTACTTGCAGTACTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	4.90%	0.53%	0.00%	T: 0.04%
All Indica	2759	99.80%	0.00%	0.07%	0.00%	T: 0.07%
All Japonica	1512	83.70%	14.80%	1.52%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.00%	0.00%	T: 0.34%
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.25%	0.00%	NA
Temperate Japonica	767	96.10%	2.70%	1.17%	0.00%	NA
Tropical Japonica	504	63.10%	34.90%	1.98%	0.00%	NA
Japonica Intermediate	241	87.10%	11.20%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0828401472	G -> C	LOC_Os08g45220.1	downstream_gene_variant ; 2385.0bp to feature; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> C	LOC_Os08g45230.1	downstream_gene_variant ; 93.0bp to feature; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> C	LOC_Os08g45220.2	downstream_gene_variant ; 2385.0bp to feature; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> C	LOC_Os08g45240.2	intron_variant ; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> C	LOC_Os08g45240.1	intron_variant ; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> C	LOC_Os08g45240.4	intron_variant ; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> T	LOC_Os08g45220.1	downstream_gene_variant ; 2385.0bp to feature; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> T	LOC_Os08g45230.1	downstream_gene_variant ; 93.0bp to feature; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> T	LOC_Os08g45220.2	downstream_gene_variant ; 2385.0bp to feature; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> T	LOC_Os08g45240.2	intron_variant ; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> T	LOC_Os08g45240.1	intron_variant ; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N
vg0828401472	G -> T	LOC_Os08g45240.4	intron_variant ; MODIFIER	silent_mutation	Average:63.83; most accessible tissue: Callus, score: 85.007	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0828401472	5.38E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.86E-06	NA	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	7.31E-06	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	3.39E-07	NA	mr1104	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	3.67E-07	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	8.38E-08	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	6.31E-06	NA	mr1204	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	6.73E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.51E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.93E-06	NA	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	1.09E-07	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	9.76E-06	NA	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	1.45E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	3.96E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	4.77E-09	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	3.32E-07	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	3.78E-10	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	1.70E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.12E-07	NA	mr1070_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	6.64E-06	NA	mr1070_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	4.88E-08	NA	mr1082_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.96E-14	NA	mr1083_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	3.22E-09	NA	mr1083_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.38E-10	NA	mr1085_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.41E-08	NA	mr1085_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.88E-06	NA	mr1088_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	3.15E-06	mr1088_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.11E-10	NA	mr1103_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.24E-06	NA	mr1103_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	7.51E-18	NA	mr1104_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.36E-10	6.75E-06	mr1104_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	3.41E-14	NA	mr1107_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.34E-08	NA	mr1107_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	4.56E-09	NA	mr1145_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	4.25E-12	NA	mr1155_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.73E-09	1.12E-08	mr1155_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	2.78E-06	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	3.77E-16	NA	mr1226_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	3.42E-08	NA	mr1226_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.07E-06	NA	mr1241_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	1.67E-06	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	1.92E-06	NA	mr1264_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	2.80E-09	NA	mr1408_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	8.97E-08	NA	mr1408_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	6.11E-08	NA	mr1437_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	3.36E-06	NA	mr1437_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	6.25E-06	NA	mr1620_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	3.00E-29	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	2.39E-13	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	6.23E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	NA	3.13E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828401472	3.46E-06	NA	mr1949_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251