\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828386953:

Variant ID: vg0828386953 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28386953
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, A: 0.21, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCGTGGACCGAAAATGAGTTTTCAGTTTACAGCCGAGTGTACATGAACCTATAGGGTCGCACGCTTAATGGGCCGGAATAAGGGGTTTGGATGGAGAT[A/C]
CAATATGAGTTTAATTCGGATAGGGATCCAAGTAGGAGTTCTACGGGCTTTGGAGGCCCGAGTGATGGATCCTATATATTTGTGAGGGGTGTGACCGGCG

Reverse complement sequence

CGCCGGTCACACCCCTCACAAATATATAGGATCCATCACTCGGGCCTCCAAAGCCCGTAGAACTCCTACTTGGATCCCTATCCGAATTAAACTCATATTG[T/G]
ATCTCCATCCAAACCCCTTATTCCGGCCCATTAAGCGTGCGACCCTATAGGTTCATGTACACTCGGCTGTAAACTGAAAACTCATTTTCGGTCCACGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 35.60% 0.00% 0.02% NA
All Indica  2759 99.00% 0.90% 0.00% 0.04% NA
All Japonica  1512 2.40% 97.60% 0.00% 0.00% NA
Aus  269 84.00% 16.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 53.30% 46.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828386953 A -> C LOC_Os08g45200.1 upstream_gene_variant ; 4332.0bp to feature; MODIFIER silent_mutation Average:61.495; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0828386953 A -> C LOC_Os08g45210.1 upstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:61.495; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0828386953 A -> C LOC_Os08g45210.2 upstream_gene_variant ; 1200.0bp to feature; MODIFIER silent_mutation Average:61.495; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0828386953 A -> C LOC_Os08g45200-LOC_Os08g45210 intergenic_region ; MODIFIER silent_mutation Average:61.495; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N
vg0828386953 A -> DEL N N silent_mutation Average:61.495; most accessible tissue: Zhenshan97 flag leaf, score: 74.162 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828386953 NA 9.52E-77 mr1100 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.23E-26 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 4.40E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.60E-70 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.51E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 4.09E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.15E-45 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 4.50E-61 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.64E-75 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 4.80E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.10E-38 mr1645 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 5.65E-33 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 3.19E-32 mr1737 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.11E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.99E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 9.89E-24 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 2.01E-44 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 5.53E-44 mr1891 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 3.54E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 5.53E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.35E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.18E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 8.58E-37 mr1541_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.45E-45 mr1591_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 7.47E-24 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.89E-32 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 5.14E-89 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 1.95E-34 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 3.05E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 6.95E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828386953 NA 3.54E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251