Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828208021:

Variant ID: vg0828208021 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 28208021
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCCGGCTTCTGGATGCTAACATGATGGATCACATCACAATTCACCCGTATTCCTTTCATTTTAAAATAAATAAATATAGTAGTTTTAGGTCATAAGAT[G/A]
TTTTAACTTTGATCAAAGTCAAACTGTTTTAAATTTAACTAAATTTATAGATAAATATAATAATATTTATATTACCAAATTGATTTTATTAAATTAATAC

Reverse complement sequence

GTATTAATTTAATAAAATCAATTTGGTAATATAAATATTATTATATTTATCTATAAATTTAGTTAAATTTAAAACAGTTTGACTTTGATCAAAGTTAAAA[C/T]
ATCTTATGACCTAAAACTACTATATTTATTTATTTTAAAATGAAAGGAATACGGGTGAATTGTGATGTGATCCATCATGTTAGCATCCAGAAGCCGGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.10%	27.30%	0.59%	0.00%	NA
All Indica	2759	61.00%	38.10%	0.98%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	21.90%	78.10%	0.00%	0.00%	NA
Indica I	595	74.30%	24.70%	1.01%	0.00%	NA
Indica II	465	83.90%	15.10%	1.08%	0.00%	NA
Indica III	913	43.30%	56.20%	0.55%	0.00%	NA
Indica Intermediate	786	57.90%	40.70%	1.40%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	77.80%	21.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0828208021	G -> A	LOC_Os08g44920.1	upstream_gene_variant ; 2760.0bp to feature; MODIFIER	silent_mutation	Average:42.848; most accessible tissue: Callus, score: 77.068	N	N	N	N
vg0828208021	G -> A	LOC_Os08g44930.1	downstream_gene_variant ; 729.0bp to feature; MODIFIER	silent_mutation	Average:42.848; most accessible tissue: Callus, score: 77.068	N	N	N	N
vg0828208021	G -> A	LOC_Os08g44940.1	downstream_gene_variant ; 4566.0bp to feature; MODIFIER	silent_mutation	Average:42.848; most accessible tissue: Callus, score: 77.068	N	N	N	N
vg0828208021	G -> A	LOC_Os08g44930.2	downstream_gene_variant ; 729.0bp to feature; MODIFIER	silent_mutation	Average:42.848; most accessible tissue: Callus, score: 77.068	N	N	N	N
vg0828208021	G -> A	LOC_Os08g44920-LOC_Os08g44930	intergenic_region ; MODIFIER	silent_mutation	Average:42.848; most accessible tissue: Callus, score: 77.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0828208021	NA	2.83E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	2.69E-06	mr1043	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	2.47E-09	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	7.81E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	3.62E-07	mr1291	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	1.82E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	1.37E-06	1.37E-06	mr1468	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	4.45E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	5.96E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	1.85E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	8.75E-07	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	2.08E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	2.59E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	2.23E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	1.74E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828208021	NA	8.66E-06	mr1543_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251