Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0828207340:

Variant ID: vg0828207340 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28207340
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGATCAAAAAAGTGTTAATTAGCTTTAATGACAGCTCCCACTAATATAAAAGGGCACAGATTCCTGTAGCTAGCCTCCTAATGTAATGGTGGTCCGGG[G/A]
ACACAAGTTGCATGCAAGGCTTCATTGCCATGAACTTTGTTTTGTTAATTACGACAGGTCATGCCGGATTAGATTACTGTATTAAGATAAGCTAGCTTCA

Reverse complement sequence

TGAAGCTAGCTTATCTTAATACAGTAATCTAATCCGGCATGACCTGTCGTAATTAACAAAACAAAGTTCATGGCAATGAAGCCTTGCATGCAACTTGTGT[C/T]
CCCGGACCACCATTACATTAGGAGGCTAGCTACAGGAATCTGTGCCCTTTTATATTAGTGGGAGCTGTCATTAAAGCTAATTAACACTTTTTTGATCTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 27.40% 0.38% 0.00% NA
All Indica  2759 61.30% 38.10% 0.65% 0.00% NA
All Japonica  1512 99.20% 0.80% 0.00% 0.00% NA
Aus  269 21.20% 78.80% 0.00% 0.00% NA
Indica I  595 74.60% 24.50% 0.84% 0.00% NA
Indica II  465 84.10% 15.10% 0.86% 0.00% NA
Indica III  913 43.70% 56.20% 0.11% 0.00% NA
Indica Intermediate  786 58.10% 40.80% 1.02% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828207340 G -> A LOC_Os08g44910.1 upstream_gene_variant ; 4619.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Minghui63 root, score: 98.411 N N N N
vg0828207340 G -> A LOC_Os08g44920.1 upstream_gene_variant ; 2079.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Minghui63 root, score: 98.411 N N N N
vg0828207340 G -> A LOC_Os08g44930.1 downstream_gene_variant ; 1410.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Minghui63 root, score: 98.411 N N N N
vg0828207340 G -> A LOC_Os08g44930.2 downstream_gene_variant ; 1410.0bp to feature; MODIFIER silent_mutation Average:68.439; most accessible tissue: Minghui63 root, score: 98.411 N N N N
vg0828207340 G -> A LOC_Os08g44920-LOC_Os08g44930 intergenic_region ; MODIFIER silent_mutation Average:68.439; most accessible tissue: Minghui63 root, score: 98.411 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0828207340 G A -0.05 -0.04 -0.01 -0.04 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828207340 NA 1.80E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 2.24E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 1.82E-09 mr1286 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 4.70E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 2.59E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 1.08E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 5.32E-06 5.31E-06 mr1468 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 2.25E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 3.78E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 1.64E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 9.64E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 7.25E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 2.30E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 8.32E-06 mr1888 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 7.04E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828207340 NA 1.51E-06 mr1975 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251