\
| Variant ID: vg0828199395 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 28199395 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTATTTTTTTAATTCTGAATTTTTATTATTTCTAATTGTATTTTGTTGACGAAAAAAATCGAACACACCGGCTTGGGAGATCTGCTTAGCTCCTGTGCA[G/A]
GTACAAAGATTGATGAGATGCGGGCTTGCCAGTCAGTTTGATCCTGCAACTGACAAGATATGCAAATAGCAGATCAAAACAGCCGATCGGCTGACAAGCC
GGCTTGTCAGCCGATCGGCTGTTTTGATCTGCTATTTGCATATCTTGTCAGTTGCAGGATCAAACTGACTGGCAAGCCCGCATCTCATCAATCTTTGTAC[C/T]
TGCACAGGAGCTAAGCAGATCTCCCAAGCCGGTGTGTTCGATTTTTTTCGTCAACAAAATACAATTAGAAATAATAAAAATTCAGAATTAAAAAAATAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.70% | 6.60% | 9.01% | 10.69% | NA |
| All Indica | 2759 | 69.20% | 0.10% | 13.59% | 17.11% | NA |
| All Japonica | 1512 | 83.50% | 13.90% | 1.79% | 0.79% | NA |
| Aus | 269 | 88.50% | 0.00% | 4.83% | 6.69% | NA |
| Indica I | 595 | 41.20% | 0.00% | 16.30% | 42.52% | NA |
| Indica II | 465 | 61.70% | 0.00% | 21.94% | 16.34% | NA |
| Indica III | 913 | 91.00% | 0.00% | 7.12% | 1.86% | NA |
| Indica Intermediate | 786 | 69.50% | 0.40% | 14.12% | 16.03% | NA |
| Temperate Japonica | 767 | 84.70% | 12.40% | 1.83% | 1.04% | NA |
| Tropical Japonica | 504 | 90.10% | 8.50% | 0.99% | 0.40% | NA |
| Japonica Intermediate | 241 | 66.00% | 29.90% | 3.32% | 0.83% | NA |
| VI/Aromatic | 96 | 9.40% | 89.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 12.20% | 11.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0828199395 | G -> A | LOC_Os08g44900.1 | upstream_gene_variant ; 2265.0bp to feature; MODIFIER | silent_mutation | Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 | N | N | N | N |
| vg0828199395 | G -> A | LOC_Os08g44910.1 | downstream_gene_variant ; 1629.0bp to feature; MODIFIER | silent_mutation | Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 | N | N | N | N |
| vg0828199395 | G -> A | LOC_Os08g44900-LOC_Os08g44910 | intergenic_region ; MODIFIER | silent_mutation | Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 | N | N | N | N |
| vg0828199395 | G -> DEL | N | N | silent_mutation | Average:12.767; most accessible tissue: Zhenshan97 root, score: 18.731 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0828199395 | NA | 9.02E-06 | mr1748 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828199395 | NA | 6.67E-09 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828199395 | NA | 7.35E-08 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828199395 | NA | 1.15E-13 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828199395 | NA | 1.01E-15 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828199395 | NA | 2.47E-16 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |