\
| Variant ID: vg0828161286 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 28161286 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )
AAGGCACTGAAATTTTCTGTAACAGATATACATCTTAAAGGAAGAAGCAGCAACCTTTTCTACGATTGACAAAGCGCATGATTGTTTGTCCCATGATAAA[C/G]
TAACTCACAGAATACCAATTTACCTATTTTACTACATTGTCAGATTCCATATGCTCATGTACAGCAGCACAATGATTCATTTGATGCTCATATTCGGTTC
GAACCGAATATGAGCATCAAATGAATCATTGTGCTGCTGTACATGAGCATATGGAATCTGACAATGTAGTAAAATAGGTAAATTGGTATTCTGTGAGTTA[G/C]
TTTATCATGGGACAAACAATCATGCGCTTTGTCAATCGTAGAAAAGGTTGCTGCTTCTTCCTTTAAGATGTATATCTGTTACAGAAAATTTCAGTGCCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.70% | 11.70% | 1.65% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 59.60% | 35.60% | 4.76% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 28.00% | 65.40% | 6.52% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 3.20% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.90% | 8.70% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 8.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0828161286 | C -> G | LOC_Os08g44830.1 | upstream_gene_variant ; 1957.0bp to feature; MODIFIER | silent_mutation | Average:45.685; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0828161286 | C -> G | LOC_Os08g44840.1 | downstream_gene_variant ; 1684.0bp to feature; MODIFIER | silent_mutation | Average:45.685; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0828161286 | C -> G | LOC_Os08g44830-LOC_Os08g44840 | intergenic_region ; MODIFIER | silent_mutation | Average:45.685; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0828161286 | NA | 2.71E-07 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | NA | 2.10E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | NA | 4.69E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | 6.83E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | 6.57E-06 | 4.56E-09 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | 2.98E-06 | 2.98E-06 | mr1659_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | NA | 3.43E-10 | mr1806_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | 3.15E-08 | NA | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | 1.22E-07 | NA | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | 4.25E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | NA | 8.79E-14 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | NA | 8.45E-06 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0828161286 | 7.34E-06 | NA | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |