\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828161286:

Variant ID: vg0828161286 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28161286
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGCACTGAAATTTTCTGTAACAGATATACATCTTAAAGGAAGAAGCAGCAACCTTTTCTACGATTGACAAAGCGCATGATTGTTTGTCCCATGATAAA[C/G]
TAACTCACAGAATACCAATTTACCTATTTTACTACATTGTCAGATTCCATATGCTCATGTACAGCAGCACAATGATTCATTTGATGCTCATATTCGGTTC

Reverse complement sequence

GAACCGAATATGAGCATCAAATGAATCATTGTGCTGCTGTACATGAGCATATGGAATCTGACAATGTAGTAAAATAGGTAAATTGGTATTCTGTGAGTTA[G/C]
TTTATCATGGGACAAACAATCATGCGCTTTGTCAATCGTAGAAAAGGTTGCTGCTTCTTCCTTTAAGATGTATATCTGTTACAGAAAATTTCAGTGCCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 11.70% 1.65% 0.00% NA
All Indica  2759 99.70% 0.20% 0.14% 0.00% NA
All Japonica  1512 59.60% 35.60% 4.76% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.70% 0.40% 0.86% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 28.00% 65.40% 6.52% 0.00% NA
Tropical Japonica  504 95.00% 3.20% 1.79% 0.00% NA
Japonica Intermediate  241 85.90% 8.70% 5.39% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 8.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828161286 C -> G LOC_Os08g44830.1 upstream_gene_variant ; 1957.0bp to feature; MODIFIER silent_mutation Average:45.685; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0828161286 C -> G LOC_Os08g44840.1 downstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:45.685; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0828161286 C -> G LOC_Os08g44830-LOC_Os08g44840 intergenic_region ; MODIFIER silent_mutation Average:45.685; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828161286 NA 2.71E-07 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 NA 2.10E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 NA 4.69E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 6.83E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 6.57E-06 4.56E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 2.98E-06 2.98E-06 mr1659_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 NA 3.43E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 3.15E-08 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 1.22E-07 NA mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 4.25E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 NA 8.79E-14 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 NA 8.45E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828161286 7.34E-06 NA mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251