Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828152822:

Variant ID: vg0828152822 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 28152822
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AGTACTAGACACTACTCTTCTAATACAAACACTACTATTCCATACTTAAATTTAATGCTACTTATCTCATATGATATCTTGGATGTTGTGTAGAAACTAT[G/A]
TTTCATGCAAGACATGGTTTCTTTCTCTTTCCTCATTTATTAACTAGATCATATTCCCCATGTTTTGCTTCAGAAAGTACTAAGAAATCTTTAATATGTT

Reverse complement sequence

AACATATTAAAGATTTCTTAGTACTTTCTGAAGCAAAACATGGGGAATATGATCTAGTTAATAAATGAGGAAAGAGAAAGAAACCATGTCTTGCATGAAA[C/T]
ATAGTTTCTACACAACATCCAAGATATCATATGAGATAAGTAGCATTAAATTTAAGTATGGAATAGTAGTGTTTGTATTAGAAGAGTAGTGTCTAGTACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.50%	3.30%	0.21%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	89.20%	10.20%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.50%	0.10%	0.39%	0.00%	NA
Tropical Japonica	504	69.40%	29.60%	0.99%	0.00%	NA
Japonica Intermediate	241	97.90%	1.70%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0828152822	G -> A	LOC_Os08g44820.1	upstream_gene_variant ; 3550.0bp to feature; MODIFIER	silent_mutation	Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143	N	N	N	N
vg0828152822	G -> A	LOC_Os08g44820.5	upstream_gene_variant ; 4370.0bp to feature; MODIFIER	silent_mutation	Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143	N	N	N	N
vg0828152822	G -> A	LOC_Os08g44820.2	upstream_gene_variant ; 3550.0bp to feature; MODIFIER	silent_mutation	Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143	N	N	N	N
vg0828152822	G -> A	LOC_Os08g44820.3	upstream_gene_variant ; 3550.0bp to feature; MODIFIER	silent_mutation	Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143	N	N	N	N
vg0828152822	G -> A	LOC_Os08g44830.1	downstream_gene_variant ; 2355.0bp to feature; MODIFIER	silent_mutation	Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143	N	N	N	N
vg0828152822	G -> A	LOC_Os08g44820-LOC_Os08g44830	intergenic_region ; MODIFIER	silent_mutation	Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0828152822	NA	1.62E-07	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	1.09E-09	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	6.32E-07	3.74E-10	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	1.07E-07	1.07E-07	mr1085	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	2.01E-07	mr1107	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	5.72E-06	5.72E-06	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	4.13E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	2.81E-08	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	1.73E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	9.61E-07	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	2.71E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	1.53E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	8.27E-07	1.00E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	3.91E-06	9.87E-06	mr1085_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	3.83E-06	1.69E-06	mr1103_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	6.57E-08	2.12E-08	mr1104_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	1.49E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	7.83E-07	6.13E-09	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822	NA	3.76E-07	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251