\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828152822:

Variant ID: vg0828152822 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28152822
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AGTACTAGACACTACTCTTCTAATACAAACACTACTATTCCATACTTAAATTTAATGCTACTTATCTCATATGATATCTTGGATGTTGTGTAGAAACTAT[G/A]
TTTCATGCAAGACATGGTTTCTTTCTCTTTCCTCATTTATTAACTAGATCATATTCCCCATGTTTTGCTTCAGAAAGTACTAAGAAATCTTTAATATGTT

Reverse complement sequence

AACATATTAAAGATTTCTTAGTACTTTCTGAAGCAAAACATGGGGAATATGATCTAGTTAATAAATGAGGAAAGAGAAAGAAACCATGTCTTGCATGAAA[C/T]
ATAGTTTCTACACAACATCCAAGATATCATATGAGATAAGTAGCATTAAATTTAAGTATGGAATAGTAGTGTTTGTATTAGAAGAGTAGTGTCTAGTACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.50% 3.30% 0.21% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 89.20% 10.20% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.10% 0.39% 0.00% NA
Tropical Japonica  504 69.40% 29.60% 0.99% 0.00% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828152822 G -> A LOC_Os08g44820.1 upstream_gene_variant ; 3550.0bp to feature; MODIFIER silent_mutation Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0828152822 G -> A LOC_Os08g44820.5 upstream_gene_variant ; 4370.0bp to feature; MODIFIER silent_mutation Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0828152822 G -> A LOC_Os08g44820.2 upstream_gene_variant ; 3550.0bp to feature; MODIFIER silent_mutation Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0828152822 G -> A LOC_Os08g44820.3 upstream_gene_variant ; 3550.0bp to feature; MODIFIER silent_mutation Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0828152822 G -> A LOC_Os08g44830.1 downstream_gene_variant ; 2355.0bp to feature; MODIFIER silent_mutation Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N
vg0828152822 G -> A LOC_Os08g44820-LOC_Os08g44830 intergenic_region ; MODIFIER silent_mutation Average:44.813; most accessible tissue: Zhenshan97 root, score: 73.143 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828152822 NA 1.62E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 1.09E-09 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 6.32E-07 3.74E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 1.07E-07 1.07E-07 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 2.01E-07 mr1107 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 5.72E-06 5.72E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 4.13E-08 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 2.81E-08 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 1.73E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 9.61E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 2.71E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 1.53E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 8.27E-07 1.00E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 3.91E-06 9.87E-06 mr1085_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 3.83E-06 1.69E-06 mr1103_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 6.57E-08 2.12E-08 mr1104_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 1.49E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 7.83E-07 6.13E-09 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828152822 NA 3.76E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251