\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828040582:

Variant ID: vg0828040582 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 28040582
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCATATTTATATAGATATTAATGAATCTAGGCACATATATATGTCTAGATTCATTAACATATATATGAATGTGGATAATGCTAGAAAGTCTTGTAATCT[G/A]
GAAAGGAGGTAGTAATATACATAGAGAGATAATTCCATATATAAGCTAAATCAGCTGGGGAGATTTTCTGTATCTATATATGGTTGGAAAATACAGTAGC

Reverse complement sequence

GCTACTGTATTTTCCAACCATATATAGATACAGAAAATCTCCCCAGCTGATTTAGCTTATATATGGAATTATCTCTCTATGTATATTACTACCTCCTTTC[C/T]
AGATTACAAGACTTTCTAGCATTATCCACATTCATATATATGTTAATGAATCTAGACATATATATGTGCCTAGATTCATTAATATCTATATAAATATGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.60% 32.20% 0.49% 6.71% NA
All Indica  2759 85.20% 2.70% 0.76% 11.34% NA
All Japonica  1512 23.50% 76.40% 0.07% 0.07% NA
Aus  269 37.20% 62.80% 0.00% 0.00% NA
Indica I  595 98.70% 0.70% 0.50% 0.17% NA
Indica II  465 87.10% 1.30% 0.86% 10.75% NA
Indica III  913 72.50% 3.20% 1.10% 23.22% NA
Indica Intermediate  786 88.70% 4.50% 0.51% 6.36% NA
Temperate Japonica  767 43.30% 56.60% 0.13% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.00% 0.20% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 60.00% 35.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0828040582 G -> A LOC_Os08g44580.1 upstream_gene_variant ; 4248.0bp to feature; MODIFIER silent_mutation Average:52.305; most accessible tissue: Callus, score: 77.641 N N N N
vg0828040582 G -> A LOC_Os08g44590.1 upstream_gene_variant ; 2627.0bp to feature; MODIFIER silent_mutation Average:52.305; most accessible tissue: Callus, score: 77.641 N N N N
vg0828040582 G -> A LOC_Os08g44580-LOC_Os08g44590 intergenic_region ; MODIFIER silent_mutation Average:52.305; most accessible tissue: Callus, score: 77.641 N N N N
vg0828040582 G -> DEL N N silent_mutation Average:52.305; most accessible tissue: Callus, score: 77.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0828040582 NA 7.90E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 6.62E-15 mr1164 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 5.85E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 7.40E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 8.58E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 2.29E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 1.66E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 2.26E-15 mr1657 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 1.50E-20 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 1.67E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 9.92E-22 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 6.18E-22 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 5.29E-29 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 1.99E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 3.82E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582 NA 5.08E-07 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251