Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0828040582:

Variant ID: vg0828040582 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 28040582
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCATATTTATATAGATATTAATGAATCTAGGCACATATATATGTCTAGATTCATTAACATATATATGAATGTGGATAATGCTAGAAAGTCTTGTAATCT[G/A]
GAAAGGAGGTAGTAATATACATAGAGAGATAATTCCATATATAAGCTAAATCAGCTGGGGAGATTTTCTGTATCTATATATGGTTGGAAAATACAGTAGC

Reverse complement sequence

GCTACTGTATTTTCCAACCATATATAGATACAGAAAATCTCCCCAGCTGATTTAGCTTATATATGGAATTATCTCTCTATGTATATTACTACCTCCTTTC[C/T]
AGATTACAAGACTTTCTAGCATTATCCACATTCATATATATGTTAATGAATCTAGACATATATATGTGCCTAGATTCATTAATATCTATATAAATATGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	32.20%	0.49%	6.71%	NA
All Indica	2759	85.20%	2.70%	0.76%	11.34%	NA
All Japonica	1512	23.50%	76.40%	0.07%	0.07%	NA
Aus	269	37.20%	62.80%	0.00%	0.00%	NA
Indica I	595	98.70%	0.70%	0.50%	0.17%	NA
Indica II	465	87.10%	1.30%	0.86%	10.75%	NA
Indica III	913	72.50%	3.20%	1.10%	23.22%	NA
Indica Intermediate	786	88.70%	4.50%	0.51%	6.36%	NA
Temperate Japonica	767	43.30%	56.60%	0.13%	0.00%	NA
Tropical Japonica	504	2.00%	97.80%	0.00%	0.20%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	60.00%	35.60%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0828040582	G -> A	LOC_Os08g44580.1	upstream_gene_variant ; 4248.0bp to feature; MODIFIER	silent_mutation	Average:52.305; most accessible tissue: Callus, score: 77.641	N	N	N	N
vg0828040582	G -> A	LOC_Os08g44590.1	upstream_gene_variant ; 2627.0bp to feature; MODIFIER	silent_mutation	Average:52.305; most accessible tissue: Callus, score: 77.641	N	N	N	N
vg0828040582	G -> A	LOC_Os08g44580-LOC_Os08g44590	intergenic_region ; MODIFIER	silent_mutation	Average:52.305; most accessible tissue: Callus, score: 77.641	N	N	N	N
vg0828040582	G -> DEL	N	N	silent_mutation	Average:52.305; most accessible tissue: Callus, score: 77.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0828040582	NA	7.90E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	6.62E-15	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	5.85E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	7.40E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	8.58E-21	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	2.29E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	1.66E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	2.26E-15	mr1657	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	1.50E-20	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	1.67E-12	mr1914	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	9.92E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	6.18E-22	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	5.29E-29	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	1.99E-29	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	3.82E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0828040582	NA	5.08E-07	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251