\
| Variant ID: vg0827974117 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27974117 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 354. )
TTCCTCTTCCCATATAATAGCTAGCTAGCTCATGCCTTCAAATTTGTAGCCACAATATACAGCAAAGATAGATAGTATCTAAGCTGGCTCATATATGCCT[C/A]
CTTTGTTTCCAGTTTCTGTTACTTTTTTTCTGTACACCTAGTGTAGGTGTATGCTTCTGAGTTTAATTGCATAATCATACTTGTATGATCTAACGCTTAG
CTAAGCGTTAGATCATACAAGTATGATTATGCAATTAAACTCAGAAGCATACACCTACACTAGGTGTACAGAAAAAAAGTAACAGAAACTGGAAACAAAG[G/T]
AGGCATATATGAGCCAGCTTAGATACTATCTATCTTTGCTGTATATTGTGGCTACAAATTTGAAGGCATGAGCTAGCTAGCTATTATATGGGAAGAGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.00% | 3.90% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.70% | 11.90% | 0.40% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 67.10% | 31.90% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.50% | 7.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827974117 | C -> A | LOC_Os08g44470.1 | upstream_gene_variant ; 3404.0bp to feature; MODIFIER | silent_mutation | Average:71.25; most accessible tissue: Zhenshan97 flower, score: 83.499 | N | N | N | N |
| vg0827974117 | C -> A | LOC_Os08g44480.3 | downstream_gene_variant ; 230.0bp to feature; MODIFIER | silent_mutation | Average:71.25; most accessible tissue: Zhenshan97 flower, score: 83.499 | N | N | N | N |
| vg0827974117 | C -> A | LOC_Os08g44480.1 | intron_variant ; MODIFIER | silent_mutation | Average:71.25; most accessible tissue: Zhenshan97 flower, score: 83.499 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827974117 | NA | 7.76E-07 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | NA | 1.38E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | 9.62E-07 | 2.86E-09 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | 1.09E-06 | 1.09E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | NA | 8.36E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | 3.34E-06 | 2.59E-08 | mr1408 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | NA | 4.93E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | NA | 4.94E-07 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | 2.02E-06 | 1.68E-08 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | NA | 7.80E-06 | mr1103_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | 3.18E-07 | 3.89E-08 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | NA | 1.60E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | 2.57E-06 | 1.72E-08 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827974117 | NA | 1.57E-07 | mr1408_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |