\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827974117:

Variant ID: vg0827974117 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27974117
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 354. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCTCTTCCCATATAATAGCTAGCTAGCTCATGCCTTCAAATTTGTAGCCACAATATACAGCAAAGATAGATAGTATCTAAGCTGGCTCATATATGCCT[C/A]
CTTTGTTTCCAGTTTCTGTTACTTTTTTTCTGTACACCTAGTGTAGGTGTATGCTTCTGAGTTTAATTGCATAATCATACTTGTATGATCTAACGCTTAG

Reverse complement sequence

CTAAGCGTTAGATCATACAAGTATGATTATGCAATTAAACTCAGAAGCATACACCTACACTAGGTGTACAGAAAAAAAGTAACAGAAACTGGAAACAAAG[G/T]
AGGCATATATGAGCCAGCTTAGATACTATCTATCTTTGCTGTATATTGTGGCTACAAATTTGAAGGCATGAGCTAGCTAGCTATTATATGGGAAGAGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 3.90% 0.13% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 87.70% 11.90% 0.40% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 67.10% 31.90% 0.99% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827974117 C -> A LOC_Os08g44470.1 upstream_gene_variant ; 3404.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 flower, score: 83.499 N N N N
vg0827974117 C -> A LOC_Os08g44480.3 downstream_gene_variant ; 230.0bp to feature; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 flower, score: 83.499 N N N N
vg0827974117 C -> A LOC_Os08g44480.1 intron_variant ; MODIFIER silent_mutation Average:71.25; most accessible tissue: Zhenshan97 flower, score: 83.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827974117 NA 7.76E-07 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 NA 1.38E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 9.62E-07 2.86E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 1.09E-06 1.09E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 NA 8.36E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 3.34E-06 2.59E-08 mr1408 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 NA 4.93E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 NA 4.94E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 2.02E-06 1.68E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 NA 7.80E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 3.18E-07 3.89E-08 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 NA 1.60E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 2.57E-06 1.72E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827974117 NA 1.57E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251