\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827935818:

Variant ID: vg0827935818 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27935818
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTGAAGGAATACATAGAAATAAAAAAAAAAGAAGAAGGGAGTCACCACAACCTTCCCAAAGGACAAAGAGACATAGTAAAAGCAAAGTGAGCATAACT[C/T]
AACTGGTTAGGTTTCTTGCTACAGAACCTGTTCATCTAGGTTAAGTCCTAAACTTGACATGAGTGCTCGCATTTTAGTGTTATGCGATGTACCCATCAAC

Reverse complement sequence

GTTGATGGGTACATCGCATAACACTAAAATGCGAGCACTCATGTCAAGTTTAGGACTTAACCTAGATGAACAGGTTCTGTAGCAAGAAACCTAACCAGTT[G/A]
AGTTATGCTCACTTTGCTTTTACTATGTCTCTTTGTCCTTTGGGAAGGTTGTGGTGACTCCCTTCTTCTTTTTTTTTTATTTCTATGTATTCCTTCACTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 8.00% 0.00% 0.00% NA
All Indica  2759 91.80% 8.20% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 49.80% 50.20% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 95.90% 4.10% 0.00% 0.00% NA
Indica III  913 89.90% 10.10% 0.00% 0.00% NA
Indica Intermediate  786 86.50% 13.50% 0.00% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827935818 C -> T LOC_Os08g44390.1 upstream_gene_variant ; 1442.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44400.1 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44390.2 upstream_gene_variant ; 1442.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44390.4 upstream_gene_variant ; 1442.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44390.3 upstream_gene_variant ; 1442.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44400.2 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44400.3 upstream_gene_variant ; 2393.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44380.1 downstream_gene_variant ; 3141.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44380.2 downstream_gene_variant ; 3141.0bp to feature; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N
vg0827935818 C -> T LOC_Os08g44390-LOC_Os08g44400 intergenic_region ; MODIFIER silent_mutation Average:71.013; most accessible tissue: Callus, score: 93.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827935818 NA 1.42E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818 NA 6.60E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818 NA 1.88E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818 3.95E-06 3.95E-06 mr1674 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818 NA 6.80E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818 NA 8.05E-08 mr1533_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827935818 NA 4.48E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251