\
| Variant ID: vg0827935818 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27935818 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 245. )
AAGTGAAGGAATACATAGAAATAAAAAAAAAAGAAGAAGGGAGTCACCACAACCTTCCCAAAGGACAAAGAGACATAGTAAAAGCAAAGTGAGCATAACT[C/T]
AACTGGTTAGGTTTCTTGCTACAGAACCTGTTCATCTAGGTTAAGTCCTAAACTTGACATGAGTGCTCGCATTTTAGTGTTATGCGATGTACCCATCAAC
GTTGATGGGTACATCGCATAACACTAAAATGCGAGCACTCATGTCAAGTTTAGGACTTAACCTAGATGAACAGGTTCTGTAGCAAGAAACCTAACCAGTT[G/A]
AGTTATGCTCACTTTGCTTTTACTATGTCTCTTTGTCCTTTGGGAAGGTTGTGGTGACTCCCTTCTTCTTTTTTTTTTATTTCTATGTATTCCTTCACTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.90% | 10.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827935818 | C -> T | LOC_Os08g44390.1 | upstream_gene_variant ; 1442.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44400.1 | upstream_gene_variant ; 2393.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44390.2 | upstream_gene_variant ; 1442.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44390.4 | upstream_gene_variant ; 1442.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44390.3 | upstream_gene_variant ; 1442.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44400.2 | upstream_gene_variant ; 2393.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44400.3 | upstream_gene_variant ; 2393.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44380.1 | downstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44380.2 | downstream_gene_variant ; 3141.0bp to feature; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| vg0827935818 | C -> T | LOC_Os08g44390-LOC_Os08g44400 | intergenic_region ; MODIFIER | silent_mutation | Average:71.013; most accessible tissue: Callus, score: 93.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827935818 | NA | 1.42E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827935818 | NA | 6.60E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827935818 | NA | 1.88E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827935818 | 3.95E-06 | 3.95E-06 | mr1674 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827935818 | NA | 6.80E-07 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827935818 | NA | 8.05E-08 | mr1533_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827935818 | NA | 4.48E-06 | mr1980_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |