\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827873144:

Variant ID: vg0827873144 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27873144
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGTTTCCCCAAGCTATAGATCTTATGCTTCCAATCTTTCTATTGCTTCAGGATTTTATCTTGCTAATGCTAGCTCTTTATGTCAAAAACAAAAAATCG[T/C]
AATTCACTTTCTTGTGCATAATGCAGTACTGGTAGTAGACAGTAGTTAGTTAGAAGCTGCATGTACCAGCGTGGCTGATGAAATCTGAATCTGAAAGGAA

Reverse complement sequence

TTCCTTTCAGATTCAGATTTCATCAGCCACGCTGGTACATGCAGCTTCTAACTAACTACTGTCTACTACCAGTACTGCATTATGCACAAGAAAGTGAATT[A/G]
CGATTTTTTGTTTTTGACATAAAGAGCTAGCATTAGCAAGATAAAATCCTGAAGCAATAGAAAGATTGGAAGCATAAGATCTATAGCTTGGGGAAACAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 4.40% 0.00% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 38.30% 61.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827873144 T -> C LOC_Os08g44260.1 upstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:71.222; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N
vg0827873144 T -> C LOC_Os08g44270.1 upstream_gene_variant ; 1998.0bp to feature; MODIFIER silent_mutation Average:71.222; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N
vg0827873144 T -> C LOC_Os08g44280.1 upstream_gene_variant ; 4199.0bp to feature; MODIFIER silent_mutation Average:71.222; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N
vg0827873144 T -> C LOC_Os08g44260.2 upstream_gene_variant ; 4827.0bp to feature; MODIFIER silent_mutation Average:71.222; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N
vg0827873144 T -> C LOC_Os08g44280.2 upstream_gene_variant ; 4199.0bp to feature; MODIFIER silent_mutation Average:71.222; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N
vg0827873144 T -> C LOC_Os08g44260-LOC_Os08g44270 intergenic_region ; MODIFIER silent_mutation Average:71.222; most accessible tissue: Zhenshan97 flower, score: 89.268 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0827873144 T C -0.01 0.01 0.0 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827873144 NA 5.40E-09 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 3.36E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 8.48E-08 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 3.51E-08 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 1.78E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 3.49E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 2.26E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 5.50E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 8.36E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 2.95E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 7.78E-10 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 2.44E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 3.05E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 5.24E-10 mr1652 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 4.15E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 4.66E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 4.66E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827873144 NA 8.94E-22 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251