\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827509408:

Variant ID: vg0827509408 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27509408
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTAGATTGGTTGACATGAACCAATCTACTGTATAATTATATTCGGTGATTCTGTATTTCTATCTTCTTCAGTGATTCTGTATTTCTGTTCCCTTCTGC[G/A]
GCAACTCAGATAGAACGCCAACTTGTAGTTTCAATATACAGTACTTGGGTGTGATTCAAGTCAACATGACACGATCTTTTTTTCTCCTTTTTGGATCACA

Reverse complement sequence

TGTGATCCAAAAAGGAGAAAAAAAGATCGTGTCATGTTGACTTGAATCACACCCAAGTACTGTATATTGAAACTACAAGTTGGCGTTCTATCTGAGTTGC[C/T]
GCAGAAGGGAACAGAAATACAGAATCACTGAAGAAGATAGAAATACAGAATCACCGAATATAATTATACAGTAGATTGGTTCATGTCAACCAATCTACTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 5.60% 0.97% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 85.30% 12.00% 2.71% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 93.00% 4.00% 3.00% 0.00% NA
Tropical Japonica  504 83.30% 14.90% 1.79% 0.00% NA
Japonica Intermediate  241 65.10% 31.10% 3.73% 0.00% NA
VI/Aromatic  96 13.50% 82.30% 4.17% 0.00% NA
Intermediate  90 95.60% 3.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827509408 G -> A LOC_Os08g43500.1 upstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:67.441; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0827509408 G -> A LOC_Os08g43480.1 downstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:67.441; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0827509408 G -> A LOC_Os08g43490.1 downstream_gene_variant ; 897.0bp to feature; MODIFIER silent_mutation Average:67.441; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0827509408 G -> A LOC_Os08g43480.2 downstream_gene_variant ; 4436.0bp to feature; MODIFIER silent_mutation Average:67.441; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N
vg0827509408 G -> A LOC_Os08g43490-LOC_Os08g43500 intergenic_region ; MODIFIER silent_mutation Average:67.441; most accessible tissue: Zhenshan97 flag leaf, score: 81.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827509408 NA 1.77E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827509408 3.38E-06 3.37E-06 mr1849 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251