\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827225389:

Variant ID: vg0827225389 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27225389
Reference Allele: TAlternative Allele: C,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.23, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTAAATGGTAATTGAACAAACATTATTGGTTAAATTTTGATAAAAAAATGTCAACTACTCCCTCCATCAAAAAATATGAGGCATAACCACCCATAACA[T/C,A]
AAAGACTAAGAAAACATTTAATCACTTTATTGGTTGGATCAGCTTGATGCATGCAAACAATGTGATTGGAGGTTTGATGATATAAGATTTAAAACAAATC

Reverse complement sequence

GATTTGTTTTAAATCTTATATCATCAAACCTCCAATCACATTGTTTGCATGCATCAAGCTGATCCAACCAATAAAGTGATTAAATGTTTTCTTAGTCTTT[A/G,T]
TGTTATGGGTGGTTATGCCTCATATTTTTTGATGGAGGGAGTAGTTGACATTTTTTTATCAAAATTTAACCAATAATGTTTGTTCAATTACCATTTACCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 42.90% 0.66% 2.92% A: 0.02%
All Indica  2759 79.00% 15.00% 1.01% 4.93% NA
All Japonica  1512 2.70% 97.10% 0.07% 0.13% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 91.60% 4.90% 3.19% 0.34% NA
Indica II  465 63.70% 14.20% 0.22% 21.94% NA
Indica III  913 80.90% 18.10% 0.33% 0.66% NA
Indica Intermediate  786 76.30% 19.70% 0.64% 3.31% NA
Temperate Japonica  767 3.10% 96.70% 0.00% 0.13% NA
Tropical Japonica  504 2.40% 97.40% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.50% 0.00% 0.41% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 40.00% 56.70% 2.22% 0.00% A: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827225389 T -> C LOC_Os08g43070.1 upstream_gene_variant ; 1430.0bp to feature; MODIFIER silent_mutation Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0827225389 T -> C LOC_Os08g43080.1 downstream_gene_variant ; 3857.0bp to feature; MODIFIER silent_mutation Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0827225389 T -> C LOC_Os08g43070-LOC_Os08g43080 intergenic_region ; MODIFIER silent_mutation Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0827225389 T -> A LOC_Os08g43070.1 upstream_gene_variant ; 1430.0bp to feature; MODIFIER silent_mutation Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0827225389 T -> A LOC_Os08g43080.1 downstream_gene_variant ; 3857.0bp to feature; MODIFIER silent_mutation Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0827225389 T -> A LOC_Os08g43070-LOC_Os08g43080 intergenic_region ; MODIFIER silent_mutation Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0827225389 T -> DEL N N silent_mutation Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827225389 NA 7.89E-12 mr1050 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.30E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.45E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.51E-27 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 4.43E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 1.69E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 1.69E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 3.51E-10 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.36E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 8.94E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 1.56E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 3.46E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.27E-09 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.31E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 5.41E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 1.99E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 1.86E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.30E-19 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 2.44E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 1.62E-06 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 7.46E-07 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 4.57E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 9.53E-08 mr1004_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389 NA 5.11E-11 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251