Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827225389:

Variant ID: vg0827225389 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 27225389
Reference Allele: T	Alternative Allele: C,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.23, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTAAATGGTAATTGAACAAACATTATTGGTTAAATTTTGATAAAAAAATGTCAACTACTCCCTCCATCAAAAAATATGAGGCATAACCACCCATAACA[T/C,A]
AAAGACTAAGAAAACATTTAATCACTTTATTGGTTGGATCAGCTTGATGCATGCAAACAATGTGATTGGAGGTTTGATGATATAAGATTTAAAACAAATC

Reverse complement sequence

GATTTGTTTTAAATCTTATATCATCAAACCTCCAATCACATTGTTTGCATGCATCAAGCTGATCCAACCAATAAAGTGATTAAATGTTTTCTTAGTCTTT[A/G,T]
TGTTATGGGTGGTTATGCCTCATATTTTTTGATGGAGGGAGTAGTTGACATTTTTTTATCAAAATTTAACCAATAATGTTTGTTCAATTACCATTTACCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.50%	42.90%	0.66%	2.92%	A: 0.02%
All Indica	2759	79.00%	15.00%	1.01%	4.93%	NA
All Japonica	1512	2.70%	97.10%	0.07%	0.13%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	91.60%	4.90%	3.19%	0.34%	NA
Indica II	465	63.70%	14.20%	0.22%	21.94%	NA
Indica III	913	80.90%	18.10%	0.33%	0.66%	NA
Indica Intermediate	786	76.30%	19.70%	0.64%	3.31%	NA
Temperate Japonica	767	3.10%	96.70%	0.00%	0.13%	NA
Tropical Japonica	504	2.40%	97.40%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.50%	0.00%	0.41%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	40.00%	56.70%	2.22%	0.00%	A: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0827225389	T -> C	LOC_Os08g43070.1	upstream_gene_variant ; 1430.0bp to feature; MODIFIER	silent_mutation	Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0827225389	T -> C	LOC_Os08g43080.1	downstream_gene_variant ; 3857.0bp to feature; MODIFIER	silent_mutation	Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0827225389	T -> C	LOC_Os08g43070-LOC_Os08g43080	intergenic_region ; MODIFIER	silent_mutation	Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0827225389	T -> A	LOC_Os08g43070.1	upstream_gene_variant ; 1430.0bp to feature; MODIFIER	silent_mutation	Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0827225389	T -> A	LOC_Os08g43080.1	downstream_gene_variant ; 3857.0bp to feature; MODIFIER	silent_mutation	Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0827225389	T -> A	LOC_Os08g43070-LOC_Os08g43080	intergenic_region ; MODIFIER	silent_mutation	Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg0827225389	T -> DEL	N	N	silent_mutation	Average:36.092; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0827225389	NA	7.89E-12	mr1050	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.30E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.45E-33	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.51E-27	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	4.43E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	1.69E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	1.69E-12	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	3.51E-10	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.36E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	8.94E-07	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	1.56E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	3.46E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.27E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.31E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	5.41E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	1.99E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	1.86E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.30E-19	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	2.44E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	1.62E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	7.46E-07	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	4.57E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	9.53E-08	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827225389	NA	5.11E-11	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251