\
| Variant ID: vg0827210810 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27210810 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 309. )
TCGACTTCAACCCTTTTAAACCTTAAACCAAAACATAGCTTCACATGATTTGCTCACTGCCCTTCAAACCAACTGGACCTGCAATGAGAGAAAAAAAATT[G/A]
AAGCATGTGATGCTGAGTTCCATATACAAACAACGTGTGTCAGATAATACTCTACATATAGCCTGATAAAAGAAACTAGACGCCGATGTAAAATGTATAT
ATATACATTTTACATCGGCGTCTAGTTTCTTTTATCAGGCTATATGTAGAGTATTATCTGACACACGTTGTTTGTATATGGAACTCAGCATCACATGCTT[C/T]
AATTTTTTTTCTCTCATTGCAGGTCCAGTTGGTTTGAAGGGCAGTGAGCAAATCATGTGAAGCTATGTTTTGGTTTAAGGTTTAAAAGGGTTGAAGTCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 92.20% | 7.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 84.00% | 16.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827210810 | G -> A | LOC_Os08g43050.1 | upstream_gene_variant ; 859.0bp to feature; MODIFIER | silent_mutation | Average:76.439; most accessible tissue: Callus, score: 91.458 | N | N | N | N |
| vg0827210810 | G -> A | LOC_Os08g43060.1 | intron_variant ; MODIFIER | silent_mutation | Average:76.439; most accessible tissue: Callus, score: 91.458 | N | N | N | N |
| vg0827210810 | G -> A | LOC_Os08g43060.2 | intron_variant ; MODIFIER | silent_mutation | Average:76.439; most accessible tissue: Callus, score: 91.458 | N | N | N | N |
| vg0827210810 | G -> A | LOC_Os08g43060.3 | intron_variant ; MODIFIER | silent_mutation | Average:76.439; most accessible tissue: Callus, score: 91.458 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827210810 | NA | 2.88E-08 | mr1078 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827210810 | NA | 1.64E-06 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827210810 | NA | 1.21E-06 | mr1096 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827210810 | NA | 1.08E-06 | mr1121 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827210810 | 3.35E-08 | 7.16E-08 | mr1246 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827210810 | NA | 2.70E-06 | mr1731 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827210810 | NA | 2.59E-06 | mr1768 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827210810 | NA | 5.30E-07 | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |