\
| Variant ID: vg0827146562 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27146562 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACCAAATTACCATATGACCACATGCATATCAATAACTATTACCACTTAGTAATCTACTAATTAAAACCAAGGAAATTAATTGTTTTAGATTGCCTAATC[T/A]
TAATGTCTACTACCTAATTGTATGGCAAGGGGCACATGCCCCCCTTCCCAAAAAAAAAACTAACACACAACTTTATACATAATTAATAGTACGATATCCT
AGGATATCGTACTATTAATTATGTATAAAGTTGTGTGTTAGTTTTTTTTTTGGGAAGGGGGGCATGTGCCCCTTGCCATACAATTAGGTAGTAGACATTA[A/T]
GATTAGGCAATCTAAAACAATTAATTTCCTTGGTTTTAATTAGTAGATTACTAAGTGGTAATAGTTATTGATATGCATGTGGTCATATGGTAATTTGGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.60% | 7.80% | 1.63% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 71.80% | 23.80% | 4.43% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 50.50% | 42.40% | 7.17% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 3.80% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 6.60% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827146562 | T -> A | LOC_Os08g42950.1 | downstream_gene_variant ; 1593.0bp to feature; MODIFIER | silent_mutation | Average:37.671; most accessible tissue: Callus, score: 82.251 | N | N | N | N |
| vg0827146562 | T -> A | LOC_Os08g42950-LOC_Os08g42960 | intergenic_region ; MODIFIER | silent_mutation | Average:37.671; most accessible tissue: Callus, score: 82.251 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827146562 | NA | 1.31E-06 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 9.40E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 7.50E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 4.17E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 9.35E-11 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 1.09E-07 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | 1.06E-07 | NA | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | 1.58E-06 | NA | mr1717_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | 7.57E-06 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 2.61E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 5.22E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 5.22E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | 5.08E-07 | 3.26E-10 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827146562 | NA | 5.77E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |