\
| Variant ID: vg0827102972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27102972 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCTTGTCTCTAAACCCATCCACTTTCTTAGCTTGATAGTCACCCCCTTTTATTATTGCCAAAATCTTGTTTCGACAGTAATTACGTTATAACTACTACAC[A/G]
AGCTATCACTAAAATCTTACGCGCAACATGTGTAGATGGGAAAAAAAACTTGCGTAAGTTTTCTAGCAAATCTGTTTATTAGTTGAAAAGTTTGTTCTAA
TTAGAACAAACTTTTCAACTAATAAACAGATTTGCTAGAAAACTTACGCAAGTTTTTTTTCCCATCTACACATGTTGCGCGTAAGATTTTAGTGATAGCT[T/C]
GTGTAGTAGTTATAACGTAATTACTGTCGAAACAAGATTTTGGCAATAATAAAAGGGGGTGACTATCAAGCTAAGAAAGTGGATGGGTTTAGAGACAAGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 6.80% | 3.83% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 68.00% | 20.60% | 11.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 46.90% | 36.60% | 16.43% | 0.00% | NA |
| Tropical Japonica | 504 | 93.10% | 2.40% | 4.56% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 7.90% | 9.54% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 5.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827102972 | A -> G | LOC_Os08g42860.1 | upstream_gene_variant ; 1470.0bp to feature; MODIFIER | silent_mutation | Average:39.016; most accessible tissue: Callus, score: 75.169 | N | N | N | N |
| vg0827102972 | A -> G | LOC_Os08g42870.1 | downstream_gene_variant ; 342.0bp to feature; MODIFIER | silent_mutation | Average:39.016; most accessible tissue: Callus, score: 75.169 | N | N | N | N |
| vg0827102972 | A -> G | LOC_Os08g42860-LOC_Os08g42870 | intergenic_region ; MODIFIER | silent_mutation | Average:39.016; most accessible tissue: Callus, score: 75.169 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827102972 | NA | 1.46E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | NA | 6.22E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | NA | 1.25E-06 | mr1568_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | NA | 7.08E-10 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | NA | 2.58E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | 4.75E-07 | NA | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | NA | 8.31E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | 2.08E-06 | 2.61E-09 | mr1946_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | 2.08E-06 | 2.61E-09 | mr1948_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | 6.58E-08 | 1.20E-10 | mr1977_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827102972 | NA | 4.12E-07 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |