Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827076816:

Variant ID: vg0827076816 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27076816
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCGGCTCCTAGCCGATCGGCTATCATTTATGGATTTAATCTCGTTTTTCTTGTCTTTTATTCTTGTTGGTTGCAGGATCAAATCAACTGGCACGCTC[A/G,T]
CGAACCTAAAAGCAAGATTTTAGACCTGCACAGGAGTTAAGCAGATCTTCCAGGCCAGTGTGTGTTTTTCGCATCAACACCCTCCTTGCTGCTCTGGCCT

Reverse complement sequence

AGGCCAGAGCAGCAAGGAGGGTGTTGATGCGAAAAACACACACTGGCCTGGAAGATCTGCTTAACTCCTGTGCAGGTCTAAAATCTTGCTTTTAGGTTCG[T/C,A]
GAGCGTGCCAGTTGATTTGATCCTGCAACCAACAAGAATAAAAGACAAGAAAAACGAGATTAAATCCATAAATGATAGCCGATCGGCTAGGAGCCGATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 11.80% 1.69% 18.73% T: 0.02%
All Indica  2759 54.50% 12.90% 2.75% 29.79% T: 0.04%
All Japonica  1512 97.40% 2.10% 0.07% 0.46% NA
Aus  269 23.80% 61.00% 0.00% 15.24% NA
Indica I  595 59.70% 13.80% 1.68% 24.71% T: 0.17%
Indica II  465 54.00% 13.30% 3.23% 29.46% NA
Indica III  913 50.90% 14.10% 2.30% 32.64% NA
Indica Intermediate  786 55.10% 10.60% 3.82% 30.53% NA
Temperate Japonica  767 99.00% 0.40% 0.13% 0.52% NA
Tropical Japonica  504 94.00% 5.80% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 92.70% 2.10% 0.00% 5.21% NA
Intermediate  90 81.10% 4.40% 3.33% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827076816 A -> G LOC_Os08g42800.1 upstream_gene_variant ; 4241.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> G LOC_Os08g42810.1 upstream_gene_variant ; 1488.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> G LOC_Os08g42820.1 downstream_gene_variant ; 74.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> G LOC_Os08g42830.1 downstream_gene_variant ; 3869.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> G LOC_Os08g42810-LOC_Os08g42820 intergenic_region ; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> T LOC_Os08g42800.1 upstream_gene_variant ; 4241.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> T LOC_Os08g42810.1 upstream_gene_variant ; 1488.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> T LOC_Os08g42820.1 downstream_gene_variant ; 74.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> T LOC_Os08g42830.1 downstream_gene_variant ; 3869.0bp to feature; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> T LOC_Os08g42810-LOC_Os08g42820 intergenic_region ; MODIFIER silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0827076816 A -> DEL N N silent_mutation Average:59.752; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827076816 NA 4.61E-06 mr1734 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251