\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827046356:

Variant ID: vg0827046356 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27046356
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAACTTTCAAATGTAACTATAGTATAATTAAAGTGTAACTGTATTGTAACTATACTTTAACTATGATATAACTTATATAAAACTTGGATTTAACCATG[T/G]
TTTGGTTGGTTAGAACCGAGATCTTACGCATGACATATTTGAAACATGCAAAAATCTTGAGGAAGTCCGATGGCTAGAAATCAGCAAATTTGAGGATAAA

Reverse complement sequence

TTTATCCTCAAATTTGCTGATTTCTAGCCATCGGACTTCCTCAAGATTTTTGCATGTTTCAAATATGTCATGCGTAAGATCTCGGTTCTAACCAACCAAA[A/C]
CATGGTTAAATCCAAGTTTTATATAAGTTATATCATAGTTAAAGTATAGTTACAATACAGTTACACTTTAATTATACTATAGTTACATTTGAAAGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.00% 7.60% 5.48% 1.88% NA
All Indica  2759 91.80% 0.10% 5.00% 3.12% NA
All Japonica  1512 68.90% 23.20% 7.80% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.10% 0.00% 7.56% 1.34% NA
Indica II  465 95.50% 0.20% 2.37% 1.94% NA
Indica III  913 92.70% 0.10% 2.08% 5.15% NA
Indica Intermediate  786 89.10% 0.10% 8.02% 2.80% NA
Temperate Japonica  767 48.20% 39.90% 11.73% 0.13% NA
Tropical Japonica  504 93.80% 3.80% 2.38% 0.00% NA
Japonica Intermediate  241 82.60% 10.80% 6.64% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 87.80% 7.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827046356 T -> G LOC_Os08g42740.2 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0827046356 T -> G LOC_Os08g42740.3 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0827046356 T -> G LOC_Os08g42740.7 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0827046356 T -> G LOC_Os08g42740.4 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0827046356 T -> G LOC_Os08g42740.5 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0827046356 T -> G LOC_Os08g42740.6 upstream_gene_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0827046356 T -> G LOC_Os08g42730-LOC_Os08g42740 intergenic_region ; MODIFIER silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N
vg0827046356 T -> DEL N N silent_mutation Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827046356 NA 8.43E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 2.83E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 6.10E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 6.01E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 2.20E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 7.26E-07 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 3.69E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 9.00E-08 NA mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 1.96E-06 NA mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 1.10E-07 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 3.55E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 6.54E-07 9.98E-10 mr1946_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 6.54E-07 9.98E-10 mr1948_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 1.81E-07 3.00E-10 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356 NA 1.15E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251