\
| Variant ID: vg0827046356 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 27046356 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAAACTTTCAAATGTAACTATAGTATAATTAAAGTGTAACTGTATTGTAACTATACTTTAACTATGATATAACTTATATAAAACTTGGATTTAACCATG[T/G]
TTTGGTTGGTTAGAACCGAGATCTTACGCATGACATATTTGAAACATGCAAAAATCTTGAGGAAGTCCGATGGCTAGAAATCAGCAAATTTGAGGATAAA
TTTATCCTCAAATTTGCTGATTTCTAGCCATCGGACTTCCTCAAGATTTTTGCATGTTTCAAATATGTCATGCGTAAGATCTCGGTTCTAACCAACCAAA[A/C]
CATGGTTAAATCCAAGTTTTATATAAGTTATATCATAGTTAAAGTATAGTTACAATACAGTTACACTTTAATTATACTATAGTTACATTTGAAAGTTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 7.60% | 5.48% | 1.88% | NA |
| All Indica | 2759 | 91.80% | 0.10% | 5.00% | 3.12% | NA |
| All Japonica | 1512 | 68.90% | 23.20% | 7.80% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 0.00% | 7.56% | 1.34% | NA |
| Indica II | 465 | 95.50% | 0.20% | 2.37% | 1.94% | NA |
| Indica III | 913 | 92.70% | 0.10% | 2.08% | 5.15% | NA |
| Indica Intermediate | 786 | 89.10% | 0.10% | 8.02% | 2.80% | NA |
| Temperate Japonica | 767 | 48.20% | 39.90% | 11.73% | 0.13% | NA |
| Tropical Japonica | 504 | 93.80% | 3.80% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 10.80% | 6.64% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0827046356 | T -> G | LOC_Os08g42740.2 | upstream_gene_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0827046356 | T -> G | LOC_Os08g42740.3 | upstream_gene_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0827046356 | T -> G | LOC_Os08g42740.7 | upstream_gene_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0827046356 | T -> G | LOC_Os08g42740.4 | upstream_gene_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0827046356 | T -> G | LOC_Os08g42740.5 | upstream_gene_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0827046356 | T -> G | LOC_Os08g42740.6 | upstream_gene_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0827046356 | T -> G | LOC_Os08g42730-LOC_Os08g42740 | intergenic_region ; MODIFIER | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| vg0827046356 | T -> DEL | N | N | silent_mutation | Average:39.971; most accessible tissue: Minghui63 root, score: 52.955 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0827046356 | NA | 8.43E-10 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 2.83E-11 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 6.10E-08 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 6.01E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 2.20E-10 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 7.26E-07 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 3.69E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | 9.00E-08 | NA | mr1712_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | 1.96E-06 | NA | mr1717_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | 1.10E-07 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 3.55E-08 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | 6.54E-07 | 9.98E-10 | mr1946_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | 6.54E-07 | 9.98E-10 | mr1948_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | 1.81E-07 | 3.00E-10 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0827046356 | NA | 1.15E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |