Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827046356:

Variant ID: vg0827046356 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 27046356
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAACTTTCAAATGTAACTATAGTATAATTAAAGTGTAACTGTATTGTAACTATACTTTAACTATGATATAACTTATATAAAACTTGGATTTAACCATG[T/G]
TTTGGTTGGTTAGAACCGAGATCTTACGCATGACATATTTGAAACATGCAAAAATCTTGAGGAAGTCCGATGGCTAGAAATCAGCAAATTTGAGGATAAA

Reverse complement sequence

TTTATCCTCAAATTTGCTGATTTCTAGCCATCGGACTTCCTCAAGATTTTTGCATGTTTCAAATATGTCATGCGTAAGATCTCGGTTCTAACCAACCAAA[A/C]
CATGGTTAAATCCAAGTTTTATATAAGTTATATCATAGTTAAAGTATAGTTACAATACAGTTACACTTTAATTATACTATAGTTACATTTGAAAGTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	7.60%	5.48%	1.88%	NA
All Indica	2759	91.80%	0.10%	5.00%	3.12%	NA
All Japonica	1512	68.90%	23.20%	7.80%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.10%	0.00%	7.56%	1.34%	NA
Indica II	465	95.50%	0.20%	2.37%	1.94%	NA
Indica III	913	92.70%	0.10%	2.08%	5.15%	NA
Indica Intermediate	786	89.10%	0.10%	8.02%	2.80%	NA
Temperate Japonica	767	48.20%	39.90%	11.73%	0.13%	NA
Tropical Japonica	504	93.80%	3.80%	2.38%	0.00%	NA
Japonica Intermediate	241	82.60%	10.80%	6.64%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	87.80%	7.80%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0827046356	T -> G	LOC_Os08g42740.2	upstream_gene_variant ; 1013.0bp to feature; MODIFIER	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0827046356	T -> G	LOC_Os08g42740.3	upstream_gene_variant ; 1013.0bp to feature; MODIFIER	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0827046356	T -> G	LOC_Os08g42740.7	upstream_gene_variant ; 1013.0bp to feature; MODIFIER	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0827046356	T -> G	LOC_Os08g42740.4	upstream_gene_variant ; 1013.0bp to feature; MODIFIER	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0827046356	T -> G	LOC_Os08g42740.5	upstream_gene_variant ; 1013.0bp to feature; MODIFIER	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0827046356	T -> G	LOC_Os08g42740.6	upstream_gene_variant ; 1013.0bp to feature; MODIFIER	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0827046356	T -> G	LOC_Os08g42730-LOC_Os08g42740	intergenic_region ; MODIFIER	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N
vg0827046356	T -> DEL	N	N	silent_mutation	Average:39.971; most accessible tissue: Minghui63 root, score: 52.955	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0827046356	NA	8.43E-10	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	2.83E-11	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	6.10E-08	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	6.01E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	2.20E-10	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	7.26E-07	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	3.69E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	9.00E-08	NA	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	1.96E-06	NA	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	1.10E-07	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	3.55E-08	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	6.54E-07	9.98E-10	mr1946_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	6.54E-07	9.98E-10	mr1948_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	1.81E-07	3.00E-10	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827046356	NA	1.15E-06	mr1977_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251