\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827033383:

Variant ID: vg0827033383 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 27033383
Reference Allele: GAGACAlternative Allele: AAGAC,G
Primary Allele: GAGACSecondary Allele: AAGAC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAAAAGGCCATAGATGCATACACATTCATGAACTCTGCCTGTTGGGGGAGAAGAAAGGATGAACTTTCAGAGTTTCAGATAGACAGTGAACTGACGGA[GAGAC/AAGAC,G]
GGACGGACGGTGAGGCCTATATAGCTTTCATCATTTGAACAGAGACATTTCGCCGGGAATCTGCTCTCCCCTCTTGACCCACCCCCAACCCCAAAGCTGT

Reverse complement sequence

ACAGCTTTGGGGTTGGGGGTGGGTCAAGAGGGGAGAGCAGATTCCCGGCGAAATGTCTCTGTTCAAATGATGAAAGCTATATAGGCCTCACCGTCCGTCC[GTCTC/GTCTT,C]
TCCGTCAGTTCACTGTCTATCTGAAACTCTGAAAGTTCATCCTTTCTTCTCCCCCAACAGGCAGAGTTCATGAATGTGTATGCATCTATGGCCTTTTCAT

Allele Frequencies:

Populations Population SizeFrequency of GAGAC(primary allele) Frequency of AAGAC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 5.50% 1.82% 0.00% G: 0.93%
All Indica  2759 98.30% 0.10% 0.04% 0.00% G: 1.56%
All Japonica  1512 77.60% 16.90% 5.49% 0.00% NA
Aus  269 99.30% 0.00% 0.37% 0.00% G: 0.37%
Indica I  595 99.70% 0.00% 0.17% 0.00% G: 0.17%
Indica II  465 92.00% 0.00% 0.00% 0.00% G: 7.96%
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.30% 0.00% 0.00% G: 0.64%
Temperate Japonica  767 91.40% 3.10% 5.48% 0.00% NA
Tropical Japonica  504 54.20% 40.90% 4.96% 0.00% NA
Japonica Intermediate  241 83.00% 10.40% 6.64% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827033383 GAGAC -> G LOC_Os08g42720.1 upstream_gene_variant ; 1229.0bp to feature; MODIFIER silent_mutation Average:93.659; most accessible tissue: Zhenshan97 flower, score: 98.688 N N N N
vg0827033383 GAGAC -> G LOC_Os08g42730.1 upstream_gene_variant ; 1545.0bp to feature; MODIFIER silent_mutation Average:93.659; most accessible tissue: Zhenshan97 flower, score: 98.688 N N N N
vg0827033383 GAGAC -> G LOC_Os08g42720-LOC_Os08g42730 intergenic_region ; MODIFIER silent_mutation Average:93.659; most accessible tissue: Zhenshan97 flower, score: 98.688 N N N N
vg0827033383 GAGAC -> AAGAC LOC_Os08g42720.1 upstream_gene_variant ; 1228.0bp to feature; MODIFIER silent_mutation Average:93.659; most accessible tissue: Zhenshan97 flower, score: 98.688 N N N N
vg0827033383 GAGAC -> AAGAC LOC_Os08g42730.1 upstream_gene_variant ; 1546.0bp to feature; MODIFIER silent_mutation Average:93.659; most accessible tissue: Zhenshan97 flower, score: 98.688 N N N N
vg0827033383 GAGAC -> AAGAC LOC_Os08g42720-LOC_Os08g42730 intergenic_region ; MODIFIER silent_mutation Average:93.659; most accessible tissue: Zhenshan97 flower, score: 98.688 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0827033383 GAGAC AAGAC 0.01 -0.01 0.02 -0.04 0.01 0.05
vg0827033383 GAGAC G 0.22 0.13 0.11 0.06 0.03 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827033383 NA 3.74E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.65E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.57E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 2.22E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 4.49E-08 mr1423 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.77E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 2.21E-07 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 5.55E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 7.45E-08 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 2.11E-33 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 7.94E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 4.97E-12 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 8.32E-16 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.45E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 8.43E-06 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 1.94E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 1.81E-08 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 9.26E-06 NA mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 3.10E-07 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 1.91E-06 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 9.73E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 9.03E-06 NA mr1246_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 1.45E-06 NA mr1264_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 3.34E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 5.72E-06 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.88E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 5.05E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 5.12E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.43E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.09E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 4.11E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 2.98E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.14E-06 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 7.94E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 6.91E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.26E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.15E-30 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 6.94E-14 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 3.55E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 2.31E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033383 NA 1.19E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251