\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827033027:

Variant ID: vg0827033027 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27033027
Reference Allele: AAlternative Allele: G,C,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTTGAATCGGTATATTTTAAAATTGATGAAGTTATCATAGGTGTCTTGTTGTTGATACGGTTGAAGTCTCCCCAGAATTCAAATGGAACCTTAAAATT[A/G,C,T]
TCTGAGTGATGCACATAGATAGCCCCAACCCTCAACGAAAACACAGTTACAAAGTTAAAGCAAGCAACCAATTAGTCAAAAAACCTCTGCGAAACATCCA

Reverse complement sequence

TGGATGTTTCGCAGAGGTTTTTTGACTAATTGGTTGCTTGCTTTAACTTTGTAACTGTGTTTTCGTTGAGGGTTGGGGCTATCTATGTGCATCACTCAGA[T/C,G,A]
AATTTTAAGGTTCCATTTGAATTCTGGGGAGACTTCAACCGTATCAACAACAAGACACCTATGATAACTTCATCAATTTTAAAATATACCGATTCAAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 14.00% 15.32% 8.70% C: 3.34%; T: 0.02%
All Indica  2759 53.80% 10.20% 18.27% 12.29% C: 5.40%
All Japonica  1512 62.90% 19.00% 13.29% 4.37% C: 0.33%; T: 0.07%
Aus  269 70.60% 27.10% 0.74% 0.37% C: 1.12%
Indica I  595 47.40% 3.90% 30.76% 6.89% C: 11.09%
Indica II  465 67.10% 3.90% 11.40% 17.42% C: 0.22%
Indica III  913 54.00% 16.00% 8.21% 14.79% C: 7.01%
Indica Intermediate  786 50.60% 12.10% 24.55% 10.43% C: 2.29%
Temperate Japonica  767 46.20% 34.20% 17.60% 1.83% C: 0.26%
Tropical Japonica  504 81.30% 1.80% 7.94% 8.33% C: 0.60%
Japonica Intermediate  241 77.60% 7.10% 10.79% 4.15% T: 0.41%
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 57.80% 16.70% 18.89% 5.56% C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827033027 A -> G LOC_Os08g42720.1 upstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> G LOC_Os08g42730.1 upstream_gene_variant ; 1902.0bp to feature; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> G LOC_Os08g42720-LOC_Os08g42730 intergenic_region ; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> C LOC_Os08g42720.1 upstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> C LOC_Os08g42730.1 upstream_gene_variant ; 1902.0bp to feature; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> C LOC_Os08g42720-LOC_Os08g42730 intergenic_region ; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> T LOC_Os08g42720.1 upstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> T LOC_Os08g42730.1 upstream_gene_variant ; 1902.0bp to feature; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> T LOC_Os08g42720-LOC_Os08g42730 intergenic_region ; MODIFIER silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N
vg0827033027 A -> DEL N N silent_mutation Average:72.872; most accessible tissue: Callus, score: 92.895 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0827033027 A C -0.1 -0.04 -0.03 0.0 -0.01 -0.01
vg0827033027 A G -0.08 -0.03 -0.02 0.01 0.0 0.0
vg0827033027 A T -0.06 -0.02 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827033027 NA 2.87E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 2.05E-09 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 3.58E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 3.60E-10 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 1.52E-11 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 5.24E-08 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 4.47E-07 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 3.55E-06 NA mr1540_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 8.11E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 1.27E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 7.48E-07 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 7.10E-08 NA mr1712_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 9.64E-06 NA mr1712_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 2.91E-06 NA mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 6.34E-06 NA mr1732_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 4.71E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 2.69E-06 3.86E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 2.69E-06 3.86E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 1.40E-06 1.22E-09 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827033027 NA 2.80E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251