\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0827030971:

Variant ID: vg0827030971 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 27030971
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAATGCTCATCCAACATTTCACTATGACAACTATATACAAAATTTTGCTGGAGATCGAGGGTGTATTTAGTTCATGCCAAAATTTGAAACGATGTGA[T/C]
GGAAAAGTTGAAAGTTTGTGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTGGAAGTTTGAAGAAAAAGTTGAGAGCTAAACCAGAGTACAAAATTTTGC

Reverse complement sequence

GCAAAATTTTGTACTCTGGTTTAGCTCTCAACTTTTTCTTCAAACTTCCAACTTTTCCATCACATCAAAACTTTCCTACACACAAACTTTCAACTTTTCC[A/G]
TCACATCGTTTCAAATTTTGGCATGAACTAAATACACCCTCGATCTCCAGCAAAATTTTGTATATAGTTGTCATAGTGAAATGTTGGATGAGCATTTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 6.30% 0.95% 58.68% NA
All Indica  2759 6.80% 3.30% 1.30% 88.58% NA
All Japonica  1512 86.60% 0.10% 0.26% 13.03% NA
Aus  269 1.90% 69.90% 1.12% 27.14% NA
Indica I  595 2.00% 0.00% 1.01% 96.97% NA
Indica II  465 4.50% 1.50% 1.08% 92.90% NA
Indica III  913 9.20% 6.50% 1.53% 82.80% NA
Indica Intermediate  786 9.00% 3.20% 1.40% 86.39% NA
Temperate Japonica  767 94.40% 0.00% 0.13% 5.48% NA
Tropical Japonica  504 74.60% 0.00% 0.40% 25.00% NA
Japonica Intermediate  241 86.70% 0.80% 0.41% 12.03% NA
VI/Aromatic  96 78.10% 13.50% 0.00% 8.33% NA
Intermediate  90 36.70% 4.40% 2.22% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0827030971 T -> C LOC_Os08g42730.1 upstream_gene_variant ; 3958.0bp to feature; MODIFIER silent_mutation Average:75.672; most accessible tissue: Zhenshan97 flower, score: 94.616 N N N N
vg0827030971 T -> C LOC_Os08g42710.1 downstream_gene_variant ; 3742.0bp to feature; MODIFIER silent_mutation Average:75.672; most accessible tissue: Zhenshan97 flower, score: 94.616 N N N N
vg0827030971 T -> C LOC_Os08g42720.1 intron_variant ; MODIFIER silent_mutation Average:75.672; most accessible tissue: Zhenshan97 flower, score: 94.616 N N N N
vg0827030971 T -> DEL N N silent_mutation Average:75.672; most accessible tissue: Zhenshan97 flower, score: 94.616 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0827030971 T C -0.01 -0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0827030971 NA 3.91E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 3.83E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 4.14E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 6.68E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.69E-16 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.12E-18 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 7.45E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.49E-17 mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 8.05E-22 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 2.20E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 4.75E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.99E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 7.20E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 3.56E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 3.31E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 2.51E-11 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 2.21E-06 2.99E-17 mr1612 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.36E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 2.07E-07 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 6.67E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 7.18E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 4.30E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.27E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.18E-18 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 3.93E-17 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 6.85E-20 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 5.58E-19 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.13E-21 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 3.12E-23 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.63E-17 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 3.19E-24 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 5.90E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.14E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 1.35E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0827030971 NA 2.42E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251